Incidental Mutation 'R6595:Bhlhe40'
ID 524862
Institutional Source Beutler Lab
Gene Symbol Bhlhe40
Ensembl Gene ENSMUSG00000030103
Gene Name basic helix-loop-helix family, member e40
Synonyms C130042M06Rik, Clast5, DEC1, CR8, Stra14, cytokine response gene 8, Sharp2, eip1 (E47 interaction protein 1), Bhlhb2, Stra13
MMRRC Submission 044719-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6595 (G1)
Quality Score 217.468
Status Validated
Chromosome 6
Chromosomal Location 108637590-108643886 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) TG to TGG at 108641818 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change at position 254 (254)
Ref Sequence ENSEMBL: ENSMUSP00000032194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032194] [ENSMUST00000163617]
AlphaFold O35185
Predicted Effect probably null
Transcript: ENSMUST00000032194
AA Change: 254
SMART Domains Protein: ENSMUSP00000032194
Gene: ENSMUSG00000030103
AA Change: 254

DomainStartEndE-ValueType
HLH 58 113 2.52e-11 SMART
ORANGE 140 184 5.91e-13 SMART
low complexity region 230 248 N/A INTRINSIC
low complexity region 372 399 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137478
Predicted Effect probably benign
Transcript: ENSMUST00000163617
SMART Domains Protein: ENSMUSP00000132157
Gene: ENSMUSG00000030103

DomainStartEndE-ValueType
HLH 58 113 2.52e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204550
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: This gene encodes a basic helix-loop-helix protein expressed in various tissues. The encoded protein can interact with Arntl or compete for E-box binding sites in the promoter of Per1 and repress Clock/Arntl's transactivation of Per1. This gene is believed to be involved in the control of circadian rhythm and cell differentiation. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutation of this gene results in impaired immune function and hyperplasia of the lymphoid organs. Aging mutant animals exhibit autoimmune disease. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 119,993,710 (GRCm39) Y1310F probably benign Het
Ankrd54 A G 15: 78,942,185 (GRCm39) F148L probably damaging Het
Bag4 C T 8: 26,259,528 (GRCm39) D224N probably damaging Het
Camk2b A T 11: 5,942,856 (GRCm39) H126Q probably damaging Het
Camsap3 G T 8: 3,654,186 (GRCm39) V608L probably damaging Het
Camsap3 A T 8: 3,658,742 (GRCm39) M796L probably damaging Het
Cdh19 T C 1: 110,853,517 (GRCm39) D308G probably benign Het
Cfap299 A T 5: 98,949,717 (GRCm39) D217V possibly damaging Het
Cpsf1 T C 15: 76,486,710 (GRCm39) I275M probably damaging Het
Cuta A G 17: 27,157,856 (GRCm39) probably null Het
Dclk2 A G 3: 86,699,374 (GRCm39) probably benign Het
Dst T G 1: 34,289,761 (GRCm39) L784R probably damaging Het
Fbn1 T C 2: 125,184,750 (GRCm39) M1681V possibly damaging Het
Fbxo9 A T 9: 77,994,494 (GRCm39) D274E probably damaging Het
Frem2 T A 3: 53,457,205 (GRCm39) D2049V probably damaging Het
Fscn3 T C 6: 28,430,174 (GRCm39) Y115H probably damaging Het
Glp2r G T 11: 67,655,603 (GRCm39) D46E probably benign Het
Gpat2 G C 2: 127,273,838 (GRCm39) G294R possibly damaging Het
Irx5 A G 8: 93,086,247 (GRCm39) Y110C probably damaging Het
Kdm5d T C Y: 939,829 (GRCm39) S994P probably benign Homo
Klhl2 A T 8: 65,196,077 (GRCm39) C555* probably null Het
Krtap4-7 A T 11: 99,534,560 (GRCm39) I101N unknown Het
Or13a27 A G 7: 139,925,560 (GRCm39) L114P probably damaging Het
Or4f57 A T 2: 111,790,515 (GRCm39) V301E possibly damaging Het
Pcdhb21 T C 18: 37,648,961 (GRCm39) S697P probably damaging Het
Pramel27 T C 4: 143,579,326 (GRCm39) C304R probably damaging Het
Rasgrf2 A T 13: 92,167,361 (GRCm39) H237Q probably damaging Het
Rnf216 A T 5: 143,076,412 (GRCm39) D157E probably benign Het
Rxrg T A 1: 167,454,905 (GRCm39) F163I probably damaging Het
Soat2 T A 15: 102,069,028 (GRCm39) I351N probably damaging Het
Srp72 C T 5: 77,132,047 (GRCm39) T242I probably benign Het
Svopl T C 6: 38,018,002 (GRCm39) probably null Het
Tbc1d2b G A 9: 90,108,145 (GRCm39) P469S probably benign Het
Tbkbp1 G A 11: 97,029,578 (GRCm39) probably benign Het
Tecta A G 9: 42,295,523 (GRCm39) V324A probably damaging Het
Twnk T C 19: 44,998,931 (GRCm39) V557A probably damaging Het
Vmn2r18 G A 5: 151,485,889 (GRCm39) T535I probably damaging Het
Zc3h14 T A 12: 98,723,285 (GRCm39) S85T probably damaging Het
Other mutations in Bhlhe40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Bhlhe40 APN 6 108,638,139 (GRCm39) missense probably benign 0.25
IGL01146:Bhlhe40 APN 6 108,641,901 (GRCm39) missense possibly damaging 0.60
IGL02950:Bhlhe40 APN 6 108,641,503 (GRCm39) missense probably damaging 1.00
teedoff UTSW 6 108,641,818 (GRCm39) frame shift probably null
R0360:Bhlhe40 UTSW 6 108,641,711 (GRCm39) missense probably damaging 1.00
R1486:Bhlhe40 UTSW 6 108,641,890 (GRCm39) missense probably damaging 1.00
R5041:Bhlhe40 UTSW 6 108,639,546 (GRCm39) missense probably damaging 0.99
R5179:Bhlhe40 UTSW 6 108,642,169 (GRCm39) missense possibly damaging 0.55
R5913:Bhlhe40 UTSW 6 108,642,154 (GRCm39) missense possibly damaging 0.79
R6281:Bhlhe40 UTSW 6 108,641,423 (GRCm39) splice site probably null
R6283:Bhlhe40 UTSW 6 108,641,992 (GRCm39) missense probably damaging 1.00
R6405:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6406:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6654:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6656:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6657:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6659:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6734:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R6968:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7105:Bhlhe40 UTSW 6 108,641,997 (GRCm39) missense possibly damaging 0.96
R7323:Bhlhe40 UTSW 6 108,642,242 (GRCm39) missense probably benign 0.42
R7395:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7399:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7472:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7563:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R7726:Bhlhe40 UTSW 6 108,639,559 (GRCm39) missense probably benign
R8058:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8319:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8320:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8380:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8381:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8428:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8431:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8432:Bhlhe40 UTSW 6 108,641,818 (GRCm39) frame shift probably null
R8988:Bhlhe40 UTSW 6 108,639,518 (GRCm39) missense probably damaging 1.00
R9381:Bhlhe40 UTSW 6 108,642,244 (GRCm39) missense probably damaging 1.00
R9582:Bhlhe40 UTSW 6 108,638,467 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AAATCTTCCCAGCTCGTCAC -3'
(R):5'- GGAACCCATCAGATCACTGC -3'

Sequencing Primer
(F):5'- TGCTTCCAGGAAACCATTGG -3'
(R):5'- TCAGATCACTGCCCGCGAAG -3'
Posted On 2018-06-22