Incidental Mutation 'R6595:Camsap3'
ID524867
Institutional Source Beutler Lab
Gene Symbol Camsap3
Ensembl Gene ENSMUSG00000044433
Gene Namecalmodulin regulated spectrin-associated protein family, member 3
SynonymsNezha, 2310057J16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.907) question?
Stock #R6595 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location3587293-3609075 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 3604186 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 608 (V608L)
Ref Sequence ENSEMBL: ENSMUSP00000146852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057028] [ENSMUST00000171962] [ENSMUST00000207077] [ENSMUST00000207432] [ENSMUST00000207533] [ENSMUST00000207712] [ENSMUST00000207970] [ENSMUST00000208240]
Predicted Effect probably benign
Transcript: ENSMUST00000057028
AA Change: V592L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000058958
Gene: ENSMUSG00000044433
AA Change: V592L

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 90 109 N/A INTRINSIC
Pfam:CH 166 315 5.5e-27 PFAM
Pfam:CAMSAP_CH 214 296 1.2e-29 PFAM
low complexity region 359 373 N/A INTRINSIC
coiled coil region 595 633 N/A INTRINSIC
low complexity region 645 655 N/A INTRINSIC
coiled coil region 696 727 N/A INTRINSIC
low complexity region 749 779 N/A INTRINSIC
low complexity region 828 837 N/A INTRINSIC
low complexity region 866 881 N/A INTRINSIC
coiled coil region 900 943 N/A INTRINSIC
low complexity region 944 965 N/A INTRINSIC
low complexity region 1002 1024 N/A INTRINSIC
CAMSAP_CKK 1111 1240 1.29e-86 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163038
Predicted Effect probably benign
Transcript: ENSMUST00000171962
AA Change: V593L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000125993
Gene: ENSMUSG00000044433
AA Change: V593L

DomainStartEndE-ValueType
low complexity region 30 45 N/A INTRINSIC
low complexity region 90 109 N/A INTRINSIC
Pfam:CAMSAP_CH 214 296 6e-31 PFAM
low complexity region 360 374 N/A INTRINSIC
Pfam:CAMSAP_CC1 587 645 1.1e-27 PFAM
low complexity region 646 656 N/A INTRINSIC
coiled coil region 697 728 N/A INTRINSIC
low complexity region 750 780 N/A INTRINSIC
low complexity region 829 838 N/A INTRINSIC
low complexity region 867 882 N/A INTRINSIC
coiled coil region 901 944 N/A INTRINSIC
low complexity region 945 966 N/A INTRINSIC
low complexity region 1003 1025 N/A INTRINSIC
CAMSAP_CKK 1112 1241 1.29e-86 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000207077
AA Change: V608L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000207152
Predicted Effect probably benign
Transcript: ENSMUST00000207432
AA Change: V619L

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000207533
Predicted Effect probably benign
Transcript: ENSMUST00000207712
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207930
Predicted Effect probably benign
Transcript: ENSMUST00000207970
AA Change: V603L

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208064
Predicted Effect probably benign
Transcript: ENSMUST00000208240
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 97% (37/38)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display variable penetrance of vascular, liver, nervous system, rib and eye abnormalities. Mice homozygous for an allele with loss of microtubule binding show partial lethality, decreased body size and abnormal alignment of microtubles in polarized epithelial cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,801,858 D217V possibly damaging Het
Abca15 A T 7: 120,394,487 Y1310F probably benign Het
Ankrd54 A G 15: 79,057,985 F148L probably damaging Het
Bag4 C T 8: 25,769,500 D224N probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Camk2b A T 11: 5,992,856 H126Q probably damaging Het
Cdh19 T C 1: 110,925,787 D308G probably benign Het
Cpsf1 T C 15: 76,602,510 I275M probably damaging Het
Cuta A G 17: 26,938,882 probably null Het
Dclk2 A G 3: 86,792,067 probably benign Het
Dst T G 1: 34,250,680 L784R probably damaging Het
Fbn1 T C 2: 125,342,830 M1681V possibly damaging Het
Fbxo9 A T 9: 78,087,212 D274E probably damaging Het
Frem2 T A 3: 53,549,784 D2049V probably damaging Het
Fscn3 T C 6: 28,430,175 Y115H probably damaging Het
Glp2r G T 11: 67,764,777 D46E probably benign Het
Gm13103 T C 4: 143,852,756 C304R probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Irx5 A G 8: 92,359,619 Y110C probably damaging Het
Kdm5d T C Y: 939,829 S994P probably benign Homo
Klhl2 A T 8: 64,743,043 C555* probably null Het
Krtap4-7 A T 11: 99,643,734 I101N unknown Het
Olfr1308 A T 2: 111,960,170 V301E possibly damaging Het
Olfr60 A G 7: 140,345,647 L114P probably damaging Het
Pcdhb21 T C 18: 37,515,908 S697P probably damaging Het
Rasgrf2 A T 13: 92,030,853 H237Q probably damaging Het
Rnf216 A T 5: 143,090,657 D157E probably benign Het
Rxrg T A 1: 167,627,336 F163I probably damaging Het
Soat2 T A 15: 102,160,593 I351N probably damaging Het
Srp72 C T 5: 76,984,200 T242I probably benign Het
Svopl T C 6: 38,041,067 probably null Het
Tbc1d2b G A 9: 90,226,092 P469S probably benign Het
Tbkbp1 G A 11: 97,138,752 probably benign Het
Tecta A G 9: 42,384,227 V324A probably damaging Het
Twnk T C 19: 45,010,492 V557A probably damaging Het
Vmn2r18 G A 5: 151,562,424 T535I probably damaging Het
Zc3h14 T A 12: 98,757,026 S85T probably damaging Het
Other mutations in Camsap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Camsap3 APN 8 3602077 missense probably damaging 1.00
IGL00797:Camsap3 APN 8 3602115 splice site probably benign
IGL01457:Camsap3 APN 8 3604795 missense probably damaging 0.98
IGL01833:Camsap3 APN 8 3608508 missense probably damaging 1.00
IGL02095:Camsap3 APN 8 3603845 missense probably damaging 1.00
IGL02880:Camsap3 APN 8 3603913 missense probably damaging 1.00
R0005:Camsap3 UTSW 8 3604288 missense probably damaging 1.00
R0049:Camsap3 UTSW 8 3598772 missense probably benign 0.11
R0049:Camsap3 UTSW 8 3598772 missense probably benign 0.11
R0347:Camsap3 UTSW 8 3602029 missense probably damaging 1.00
R0926:Camsap3 UTSW 8 3587960 critical splice donor site probably null
R0946:Camsap3 UTSW 8 3604442 missense probably benign 0.00
R1169:Camsap3 UTSW 8 3603866 missense probably damaging 1.00
R1206:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1207:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1207:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1454:Camsap3 UTSW 8 3603968 missense possibly damaging 0.58
R1475:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1581:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1618:Camsap3 UTSW 8 3598740 missense probably benign 0.25
R1820:Camsap3 UTSW 8 3603485 missense probably damaging 1.00
R1899:Camsap3 UTSW 8 3603922 nonsense probably null
R1914:Camsap3 UTSW 8 3604708 missense probably damaging 1.00
R1952:Camsap3 UTSW 8 3604789 missense probably damaging 0.99
R2338:Camsap3 UTSW 8 3606808 missense probably damaging 1.00
R3725:Camsap3 UTSW 8 3603785 missense probably damaging 1.00
R3726:Camsap3 UTSW 8 3603785 missense probably damaging 1.00
R4528:Camsap3 UTSW 8 3606515 missense possibly damaging 0.79
R4652:Camsap3 UTSW 8 3600689 missense possibly damaging 0.87
R5025:Camsap3 UTSW 8 3604244 missense probably damaging 1.00
R5120:Camsap3 UTSW 8 3600680 missense probably damaging 0.97
R5381:Camsap3 UTSW 8 3603812 missense probably damaging 1.00
R5388:Camsap3 UTSW 8 3604276 missense probably damaging 1.00
R5829:Camsap3 UTSW 8 3597899 missense probably damaging 1.00
R5846:Camsap3 UTSW 8 3603980 missense probably damaging 1.00
R5935:Camsap3 UTSW 8 3601999 missense probably damaging 1.00
R6363:Camsap3 UTSW 8 3601971 missense probably damaging 1.00
R6469:Camsap3 UTSW 8 3603941 missense possibly damaging 0.79
R6595:Camsap3 UTSW 8 3608742 missense probably damaging 1.00
R7024:Camsap3 UTSW 8 3608242 missense probably damaging 0.98
R7062:Camsap3 UTSW 8 3607834 unclassified probably benign
R7109:Camsap3 UTSW 8 3598087 missense possibly damaging 0.53
R7233:Camsap3 UTSW 8 3600371 missense probably damaging 0.99
R7236:Camsap3 UTSW 8 3604116 missense probably damaging 1.00
R7316:Camsap3 UTSW 8 3604648 missense possibly damaging 0.51
R7340:Camsap3 UTSW 8 3587960 critical splice donor site probably null
R7512:Camsap3 UTSW 8 3598740 missense probably benign 0.25
R7779:Camsap3 UTSW 8 3597887 missense probably damaging 1.00
R8134:Camsap3 UTSW 8 3598075 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGCTGTCTGATAGGCTCAACAAG -3'
(R):5'- GGTAACTGACTTGTGCCGTAAG -3'

Sequencing Primer
(F):5'- GGCTCAACAAGGCGCCTATC -3'
(R):5'- TAAGGACGGCTCACCCTG -3'
Posted On2018-06-22