Incidental Mutation 'R6627:Sh2d4a'
ID524870
Institutional Source Beutler Lab
Gene Symbol Sh2d4a
Ensembl Gene ENSMUSG00000053886
Gene NameSH2 domain containing 4A
SynonymsSH2A, 2210402M20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6627 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location68276567-68347699 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 68294318 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 66 (V66D)
Ref Sequence ENSEMBL: ENSMUSP00000070825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066594]
Predicted Effect probably damaging
Transcript: ENSMUST00000066594
AA Change: V66D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070825
Gene: ENSMUSG00000053886
AA Change: V66D

DomainStartEndE-ValueType
low complexity region 248 266 N/A INTRINSIC
SH2 313 396 2.5e-22 SMART
Predicted Effect unknown
Transcript: ENSMUST00000212166
AA Change: V40D
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213094
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display normal T cell development, homeostasis, proliferation, and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 T C 18: 12,262,164 N224S probably benign Het
Ccdc162 A G 10: 41,663,185 S396P probably damaging Het
Cd9 A G 6: 125,462,412 L119P possibly damaging Het
Cdk17 A C 10: 93,232,412 T311P probably damaging Het
Cep89 A G 7: 35,427,747 D511G possibly damaging Het
Coq3 T C 4: 21,908,607 V286A possibly damaging Het
Cyp2j13 G A 4: 96,059,106 T236I probably damaging Het
Ddx46 T C 13: 55,652,935 V301A probably benign Het
Dnah10 A T 5: 124,830,033 I4209F probably damaging Het
E2f5 G A 3: 14,603,857 E270K probably benign Het
Esp24 C T 17: 39,040,061 Q51* probably null Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Fasn G T 11: 120,818,927 Q435K probably benign Het
Gpr17 T C 18: 31,947,896 Y38C probably damaging Het
Ikbkap A T 4: 56,784,647 probably null Het
Lfng T C 5: 140,607,768 V118A probably damaging Het
Muc5ac T C 7: 141,808,690 probably benign Het
Myh1 T G 11: 67,215,009 L1150R probably damaging Het
Plod3 T G 5: 136,988,456 I111S probably damaging Het
Simc1 T G 13: 54,547,074 L323V probably damaging Het
Thnsl2 A G 6: 71,134,215 I223T possibly damaging Het
Tmem203 T C 2: 25,255,773 probably null Het
Tmem57 A G 4: 134,836,343 V110A probably damaging Het
Tmppe A G 9: 114,405,485 D284G probably damaging Het
Ube2s C T 7: 4,810,582 R61H possibly damaging Het
Other mutations in Sh2d4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Sh2d4a APN 8 68329366 splice site probably null
R0078:Sh2d4a UTSW 8 68282321 missense probably damaging 0.98
R0608:Sh2d4a UTSW 8 68346694 missense possibly damaging 0.92
R0701:Sh2d4a UTSW 8 68331095 missense probably damaging 1.00
R0924:Sh2d4a UTSW 8 68335123 missense probably damaging 1.00
R0930:Sh2d4a UTSW 8 68335123 missense probably damaging 1.00
R1690:Sh2d4a UTSW 8 68294449 missense probably benign 0.00
R1744:Sh2d4a UTSW 8 68331155 missense possibly damaging 0.93
R1864:Sh2d4a UTSW 8 68329315 missense probably benign 0.38
R2011:Sh2d4a UTSW 8 68346742 missense probably benign 0.02
R2014:Sh2d4a UTSW 8 68331083 missense probably damaging 1.00
R2172:Sh2d4a UTSW 8 68296664 missense probably benign 0.00
R4010:Sh2d4a UTSW 8 68335147 missense probably damaging 1.00
R4542:Sh2d4a UTSW 8 68346742 missense probably benign 0.01
R5522:Sh2d4a UTSW 8 68296697 missense probably benign 0.38
R7482:Sh2d4a UTSW 8 68296676 missense probably benign
R7807:Sh2d4a UTSW 8 68282381 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTCTCAACATCTGGCAGGC -3'
(R):5'- CAGTAAAGGCAGCGAGTCTCTG -3'

Sequencing Primer
(F):5'- ATCTGGCAGGCGCAAAC -3'
(R):5'- CGAGTCTCTGGCTGGAGTAC -3'
Posted On2018-06-22