Incidental Mutation 'R6627:Tmppe'
ID524872
Institutional Source Beutler Lab
Gene Symbol Tmppe
Ensembl Gene ENSMUSG00000079260
Gene Nametransmembrane protein with metallophosphoesterase domain
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.614) question?
Stock #R6627 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location114401105-114407276 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114405485 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 284 (D284G)
Ref Sequence ENSEMBL: ENSMUSP00000107451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063042] [ENSMUST00000111820] [ENSMUST00000217583]
Predicted Effect probably benign
Transcript: ENSMUST00000063042
SMART Domains Protein: ENSMUSP00000055803
Gene: ENSMUSG00000045594

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Glyco_hydro_35 41 358 2.5e-129 PFAM
Pfam:Glyco_hydro_42 56 216 9.4e-15 PFAM
Pfam:BetaGal_dom4_5 531 623 4.3e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111820
AA Change: D284G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107451
Gene: ENSMUSG00000079260
AA Change: D284G

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
transmembrane domain 42 64 N/A INTRINSIC
transmembrane domain 84 106 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:Metallophos 207 389 5.1e-13 PFAM
Pfam:Metallophos_2 207 421 7.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217583
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 T C 18: 12,262,164 N224S probably benign Het
Ccdc162 A G 10: 41,663,185 S396P probably damaging Het
Cd9 A G 6: 125,462,412 L119P possibly damaging Het
Cdk17 A C 10: 93,232,412 T311P probably damaging Het
Cep89 A G 7: 35,427,747 D511G possibly damaging Het
Coq3 T C 4: 21,908,607 V286A possibly damaging Het
Cyp2j13 G A 4: 96,059,106 T236I probably damaging Het
Ddx46 T C 13: 55,652,935 V301A probably benign Het
Dnah10 A T 5: 124,830,033 I4209F probably damaging Het
E2f5 G A 3: 14,603,857 E270K probably benign Het
Esp24 C T 17: 39,040,061 Q51* probably null Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Fasn G T 11: 120,818,927 Q435K probably benign Het
Gpr17 T C 18: 31,947,896 Y38C probably damaging Het
Ikbkap A T 4: 56,784,647 probably null Het
Lfng T C 5: 140,607,768 V118A probably damaging Het
Muc5ac T C 7: 141,808,690 probably benign Het
Myh1 T G 11: 67,215,009 L1150R probably damaging Het
Plod3 T G 5: 136,988,456 I111S probably damaging Het
Sh2d4a T A 8: 68,294,318 V66D probably damaging Het
Simc1 T G 13: 54,547,074 L323V probably damaging Het
Thnsl2 A G 6: 71,134,215 I223T possibly damaging Het
Tmem203 T C 2: 25,255,773 probably null Het
Tmem57 A G 4: 134,836,343 V110A probably damaging Het
Ube2s C T 7: 4,810,582 R61H possibly damaging Het
Other mutations in Tmppe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01823:Tmppe APN 9 114405107 missense probably benign 0.03
IGL02274:Tmppe APN 9 114405431 missense probably benign
IGL02349:Tmppe APN 9 114405200 missense probably benign
R0201:Tmppe UTSW 9 114404639 frame shift probably null
R1668:Tmppe UTSW 9 114404900 missense possibly damaging 0.89
R2206:Tmppe UTSW 9 114405572 missense probably benign
R5026:Tmppe UTSW 9 114405819 missense possibly damaging 0.90
R5054:Tmppe UTSW 9 114405958 missense probably benign 0.41
R5118:Tmppe UTSW 9 114405481 missense probably benign 0.02
R5623:Tmppe UTSW 9 114405896 missense possibly damaging 0.59
R6307:Tmppe UTSW 9 114404744 missense probably benign 0.00
R6502:Tmppe UTSW 9 114405652 missense probably damaging 1.00
R6597:Tmppe UTSW 9 114405244 missense probably benign 0.00
R6888:Tmppe UTSW 9 114404701 missense probably damaging 1.00
R6954:Tmppe UTSW 9 114405523 missense probably benign 0.06
R7032:Tmppe UTSW 9 114405790 missense probably damaging 1.00
R7141:Tmppe UTSW 9 114404968 missense probably benign 0.00
R7642:Tmppe UTSW 9 114404794 missense possibly damaging 0.95
Z1088:Tmppe UTSW 9 114405077 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTGACATTCACTTGGGGCC -3'
(R):5'- TGTCAAGGTCCATGCCATG -3'

Sequencing Primer
(F):5'- ATTCACTTGGGGCCCACAGTG -3'
(R):5'- ATGCCATGCCCAGAGTAGTG -3'
Posted On2018-06-22