Incidental Mutation 'R6627:Cdk17'
ID524875
Institutional Source Beutler Lab
Gene Symbol Cdk17
Ensembl Gene ENSMUSG00000020015
Gene Namecyclin-dependent kinase 17
SynonymsPctk2, 6430598J10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.235) question?
Stock #R6627 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location93160875-93267071 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 93232412 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 311 (T311P)
Ref Sequence ENSEMBL: ENSMUSP00000150873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069965] [ENSMUST00000215286]
Predicted Effect probably damaging
Transcript: ENSMUST00000069965
AA Change: T344P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070355
Gene: ENSMUSG00000020015
AA Change: T344P

DomainStartEndE-ValueType
S_TKc 192 473 4.67e-97 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000215286
AA Change: T311P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cdc2/cdkx subfamily of the ser/thr family of protein kinases. It has similarity to a rat protein that is thought to play a role in terminally differentiated neurons. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd29 T C 18: 12,262,164 N224S probably benign Het
Ccdc162 A G 10: 41,663,185 S396P probably damaging Het
Cd9 A G 6: 125,462,412 L119P possibly damaging Het
Cep89 A G 7: 35,427,747 D511G possibly damaging Het
Coq3 T C 4: 21,908,607 V286A possibly damaging Het
Cyp2j13 G A 4: 96,059,106 T236I probably damaging Het
Ddx46 T C 13: 55,652,935 V301A probably benign Het
Dnah10 A T 5: 124,830,033 I4209F probably damaging Het
E2f5 G A 3: 14,603,857 E270K probably benign Het
Esp24 C T 17: 39,040,061 Q51* probably null Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Fasn G T 11: 120,818,927 Q435K probably benign Het
Gpr17 T C 18: 31,947,896 Y38C probably damaging Het
Ikbkap A T 4: 56,784,647 probably null Het
Lfng T C 5: 140,607,768 V118A probably damaging Het
Muc5ac T C 7: 141,808,690 probably benign Het
Myh1 T G 11: 67,215,009 L1150R probably damaging Het
Plod3 T G 5: 136,988,456 I111S probably damaging Het
Sh2d4a T A 8: 68,294,318 V66D probably damaging Het
Simc1 T G 13: 54,547,074 L323V probably damaging Het
Thnsl2 A G 6: 71,134,215 I223T possibly damaging Het
Tmem203 T C 2: 25,255,773 probably null Het
Tmem57 A G 4: 134,836,343 V110A probably damaging Het
Tmppe A G 9: 114,405,485 D284G probably damaging Het
Ube2s C T 7: 4,810,582 R61H possibly damaging Het
Other mutations in Cdk17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Cdk17 APN 10 93226771 missense probably damaging 1.00
IGL00781:Cdk17 APN 10 93232416 missense probably damaging 1.00
IGL01622:Cdk17 APN 10 93238962 unclassified probably benign
IGL01623:Cdk17 APN 10 93238962 unclassified probably benign
IGL01732:Cdk17 APN 10 93218045 missense probably benign 0.01
IGL01768:Cdk17 APN 10 93208261 missense probably damaging 0.99
IGL02942:Cdk17 APN 10 93238968 missense probably benign
IGL03308:Cdk17 APN 10 93221644 critical splice donor site probably null
R0039:Cdk17 UTSW 10 93226778 splice site probably benign
R0398:Cdk17 UTSW 10 93237840 missense probably benign 0.01
R0432:Cdk17 UTSW 10 93237790 unclassified probably benign
R0609:Cdk17 UTSW 10 93216472 missense probably benign
R0781:Cdk17 UTSW 10 93239033 nonsense probably null
R1110:Cdk17 UTSW 10 93239033 nonsense probably null
R1604:Cdk17 UTSW 10 93232498 missense probably damaging 1.00
R1674:Cdk17 UTSW 10 93221630 missense probably benign 0.21
R1758:Cdk17 UTSW 10 93208250 missense probably damaging 1.00
R1797:Cdk17 UTSW 10 93208252 missense possibly damaging 0.76
R1864:Cdk17 UTSW 10 93226105 missense probably damaging 1.00
R1924:Cdk17 UTSW 10 93226117 missense probably damaging 1.00
R1929:Cdk17 UTSW 10 93228678 missense probably damaging 1.00
R2143:Cdk17 UTSW 10 93218019 missense probably damaging 1.00
R2207:Cdk17 UTSW 10 93228762 missense probably damaging 1.00
R2261:Cdk17 UTSW 10 93211958 missense possibly damaging 0.90
R2262:Cdk17 UTSW 10 93211958 missense possibly damaging 0.90
R3737:Cdk17 UTSW 10 93221644 critical splice donor site probably null
R3883:Cdk17 UTSW 10 93212077 critical splice donor site probably null
R4436:Cdk17 UTSW 10 93211896 splice site probably null
R5372:Cdk17 UTSW 10 93226039 missense probably benign 0.03
R5444:Cdk17 UTSW 10 93217961 splice site probably null
R5488:Cdk17 UTSW 10 93232412 missense probably damaging 1.00
R5489:Cdk17 UTSW 10 93232412 missense probably damaging 1.00
R5815:Cdk17 UTSW 10 93228697 missense probably damaging 1.00
R6164:Cdk17 UTSW 10 93235469 missense probably benign 0.26
R6209:Cdk17 UTSW 10 93208231 missense probably benign 0.05
R6384:Cdk17 UTSW 10 93211965 missense probably damaging 0.99
R6698:Cdk17 UTSW 10 93228678 missense probably damaging 1.00
R7164:Cdk17 UTSW 10 93232481 missense probably benign 0.07
R8096:Cdk17 UTSW 10 93216367 missense probably damaging 0.98
R8118:Cdk17 UTSW 10 93216390 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- CTTGGCCCAGGACTACATAC -3'
(R):5'- AGGCACGGGCTACTAATGTG -3'

Sequencing Primer
(F):5'- AGGACTACATACACTCAACAGAG -3'
(R):5'- CACGGGCTACTAATGTGAATAAG -3'
Posted On2018-06-22