Incidental Mutation 'R6595:Irx5'
ID524876
Institutional Source Beutler Lab
Gene Symbol Irx5
Ensembl Gene ENSMUSG00000031737
Gene NameIroquois homeobox 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6595 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location92357625-92376286 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92359619 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 110 (Y110C)
Ref Sequence ENSEMBL: ENSMUSP00000034184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034184] [ENSMUST00000210246]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000034183
Predicted Effect probably damaging
Transcript: ENSMUST00000034184
AA Change: Y110C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034184
Gene: ENSMUSG00000031737
AA Change: Y110C

DomainStartEndE-ValueType
HOX 112 177 1.14e-12 SMART
low complexity region 185 202 N/A INTRINSIC
low complexity region 245 257 N/A INTRINSIC
low complexity region 307 327 N/A INTRINSIC
IRO 328 345 2.28e-5 SMART
low complexity region 351 369 N/A INTRINSIC
low complexity region 375 389 N/A INTRINSIC
low complexity region 417 439 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179222
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180102
Predicted Effect probably damaging
Transcript: ENSMUST00000210246
AA Change: Y110C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 97% (37/38)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body size, narrow eye opening, and impaired retinal cone bipolar cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,801,858 D217V possibly damaging Het
Abca15 A T 7: 120,394,487 Y1310F probably benign Het
Ankrd54 A G 15: 79,057,985 F148L probably damaging Het
Bag4 C T 8: 25,769,500 D224N probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Camk2b A T 11: 5,992,856 H126Q probably damaging Het
Camsap3 G T 8: 3,604,186 V608L probably damaging Het
Camsap3 A T 8: 3,608,742 M796L probably damaging Het
Cdh19 T C 1: 110,925,787 D308G probably benign Het
Cpsf1 T C 15: 76,602,510 I275M probably damaging Het
Cuta A G 17: 26,938,882 probably null Het
Dclk2 A G 3: 86,792,067 probably benign Het
Dst T G 1: 34,250,680 L784R probably damaging Het
Fbn1 T C 2: 125,342,830 M1681V possibly damaging Het
Fbxo9 A T 9: 78,087,212 D274E probably damaging Het
Frem2 T A 3: 53,549,784 D2049V probably damaging Het
Fscn3 T C 6: 28,430,175 Y115H probably damaging Het
Glp2r G T 11: 67,764,777 D46E probably benign Het
Gm13103 T C 4: 143,852,756 C304R probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Kdm5d T C Y: 939,829 S994P probably benign Homo
Klhl2 A T 8: 64,743,043 C555* probably null Het
Krtap4-7 A T 11: 99,643,734 I101N unknown Het
Olfr1308 A T 2: 111,960,170 V301E possibly damaging Het
Olfr60 A G 7: 140,345,647 L114P probably damaging Het
Pcdhb21 T C 18: 37,515,908 S697P probably damaging Het
Rasgrf2 A T 13: 92,030,853 H237Q probably damaging Het
Rnf216 A T 5: 143,090,657 D157E probably benign Het
Rxrg T A 1: 167,627,336 F163I probably damaging Het
Soat2 T A 15: 102,160,593 I351N probably damaging Het
Srp72 C T 5: 76,984,200 T242I probably benign Het
Svopl T C 6: 38,041,067 probably null Het
Tbc1d2b G A 9: 90,226,092 P469S probably benign Het
Tbkbp1 G A 11: 97,138,752 probably benign Het
Tecta A G 9: 42,384,227 V324A probably damaging Het
Twnk T C 19: 45,010,492 V557A probably damaging Het
Vmn2r18 G A 5: 151,562,424 T535I probably damaging Het
Zc3h14 T A 12: 98,757,026 S85T probably damaging Het
Other mutations in Irx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01735:Irx5 APN 8 92360703 missense probably damaging 1.00
IGL01870:Irx5 APN 8 92359777 missense probably damaging 1.00
IGL01985:Irx5 APN 8 92359527 splice site probably benign
IGL02481:Irx5 APN 8 92360679 missense probably damaging 1.00
IGL02597:Irx5 APN 8 92360772 missense possibly damaging 0.93
IGL03257:Irx5 APN 8 92360630 missense probably benign 0.00
R0784:Irx5 UTSW 8 92360490 missense probably benign
R1498:Irx5 UTSW 8 92359886 missense probably damaging 1.00
R1762:Irx5 UTSW 8 92359644 missense probably damaging 1.00
R1783:Irx5 UTSW 8 92359688 missense probably damaging 1.00
R1951:Irx5 UTSW 8 92359810 missense probably damaging 1.00
R1953:Irx5 UTSW 8 92359810 missense probably damaging 1.00
R2019:Irx5 UTSW 8 92358364 missense probably damaging 1.00
R3875:Irx5 UTSW 8 92360165 missense probably benign 0.00
R3942:Irx5 UTSW 8 92359686 missense probably damaging 0.98
R4361:Irx5 UTSW 8 92358397 missense probably damaging 0.99
R4574:Irx5 UTSW 8 92358262 missense probably damaging 0.99
R4994:Irx5 UTSW 8 92360781 missense probably damaging 1.00
R5579:Irx5 UTSW 8 92359913 missense probably benign 0.01
R5884:Irx5 UTSW 8 92360630 missense possibly damaging 0.95
R5988:Irx5 UTSW 8 92360671 nonsense probably null
R6017:Irx5 UTSW 8 92358250 missense probably damaging 1.00
R6339:Irx5 UTSW 8 92359853 missense probably damaging 0.99
R6466:Irx5 UTSW 8 92359726 missense probably damaging 1.00
R7344:Irx5 UTSW 8 92359555 missense probably benign 0.24
R8166:Irx5 UTSW 8 92360084 splice site probably null
R8215:Irx5 UTSW 8 92359613 missense possibly damaging 0.77
R8396:Irx5 UTSW 8 92360334 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GCTGGCACTCAAAACCAAGG -3'
(R):5'- GCATCCACCAACCTGATTCG -3'

Sequencing Primer
(F):5'- CACTCAAAACCAAGGACAGAGGG -3'
(R):5'- GGCGTCCACGTCATCTTG -3'
Posted On2018-06-22