Incidental Mutation 'R6595:Tbc1d2b'
ID524881
Institutional Source Beutler Lab
Gene Symbol Tbc1d2b
Ensembl Gene ENSMUSG00000037410
Gene NameTBC1 domain family, member 2B
Synonyms1810061M12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6595 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location90202027-90270804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 90226092 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 469 (P469S)
Ref Sequence ENSEMBL: ENSMUSP00000045413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041767] [ENSMUST00000144348]
Predicted Effect probably benign
Transcript: ENSMUST00000041767
AA Change: P469S

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000045413
Gene: ENSMUSG00000037410
AA Change: P469S

DomainStartEndE-ValueType
PH 35 141 2.66e-9 SMART
low complexity region 324 334 N/A INTRINSIC
low complexity region 343 356 N/A INTRINSIC
Blast:TBC 358 601 2e-25 BLAST
TBC 661 881 3.75e-60 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120385
Predicted Effect probably benign
Transcript: ENSMUST00000144348
Meta Mutation Damage Score 0.0603 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,801,858 D217V possibly damaging Het
Abca15 A T 7: 120,394,487 Y1310F probably benign Het
Ankrd54 A G 15: 79,057,985 F148L probably damaging Het
Bag4 C T 8: 25,769,500 D224N probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Camk2b A T 11: 5,992,856 H126Q probably damaging Het
Camsap3 G T 8: 3,604,186 V608L probably damaging Het
Camsap3 A T 8: 3,608,742 M796L probably damaging Het
Cdh19 T C 1: 110,925,787 D308G probably benign Het
Cpsf1 T C 15: 76,602,510 I275M probably damaging Het
Cuta A G 17: 26,938,882 probably null Het
Dclk2 A G 3: 86,792,067 probably benign Het
Dst T G 1: 34,250,680 L784R probably damaging Het
Fbn1 T C 2: 125,342,830 M1681V possibly damaging Het
Fbxo9 A T 9: 78,087,212 D274E probably damaging Het
Frem2 T A 3: 53,549,784 D2049V probably damaging Het
Fscn3 T C 6: 28,430,175 Y115H probably damaging Het
Glp2r G T 11: 67,764,777 D46E probably benign Het
Gm13103 T C 4: 143,852,756 C304R probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Irx5 A G 8: 92,359,619 Y110C probably damaging Het
Kdm5d T C Y: 939,829 S994P probably benign Homo
Klhl2 A T 8: 64,743,043 C555* probably null Het
Krtap4-7 A T 11: 99,643,734 I101N unknown Het
Olfr1308 A T 2: 111,960,170 V301E possibly damaging Het
Olfr60 A G 7: 140,345,647 L114P probably damaging Het
Pcdhb21 T C 18: 37,515,908 S697P probably damaging Het
Rasgrf2 A T 13: 92,030,853 H237Q probably damaging Het
Rnf216 A T 5: 143,090,657 D157E probably benign Het
Rxrg T A 1: 167,627,336 F163I probably damaging Het
Soat2 T A 15: 102,160,593 I351N probably damaging Het
Srp72 C T 5: 76,984,200 T242I probably benign Het
Svopl T C 6: 38,041,067 probably null Het
Tbkbp1 G A 11: 97,138,752 probably benign Het
Tecta A G 9: 42,384,227 V324A probably damaging Het
Twnk T C 19: 45,010,492 V557A probably damaging Het
Vmn2r18 G A 5: 151,562,424 T535I probably damaging Het
Zc3h14 T A 12: 98,757,026 S85T probably damaging Het
Other mutations in Tbc1d2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Tbc1d2b APN 9 90226209 missense probably benign
IGL00791:Tbc1d2b APN 9 90227428 missense probably benign 0.18
IGL01457:Tbc1d2b APN 9 90205091 missense probably damaging 1.00
IGL01535:Tbc1d2b APN 9 90215473 splice site probably benign
IGL02089:Tbc1d2b APN 9 90222359 missense possibly damaging 0.80
IGL02409:Tbc1d2b APN 9 90222352 missense probably benign 0.00
IGL02799:Tbc1d2b APN 9 90223434 splice site probably benign
IGL03198:Tbc1d2b APN 9 90222457 missense probably damaging 1.00
Leone UTSW 9 90207887 missense probably damaging 1.00
panthera UTSW 9 90226248 missense probably benign
pardo UTSW 9 90219144 missense probably benign 0.13
pardus UTSW 9 90219010 nonsense probably null
roar UTSW 9 90218922 nonsense probably null
R0062:Tbc1d2b UTSW 9 90222302 splice site probably benign
R0062:Tbc1d2b UTSW 9 90222302 splice site probably benign
R0671:Tbc1d2b UTSW 9 90222505 splice site probably benign
R0682:Tbc1d2b UTSW 9 90249862 missense probably benign 0.01
R1074:Tbc1d2b UTSW 9 90222340 missense possibly damaging 0.68
R1075:Tbc1d2b UTSW 9 90222340 missense possibly damaging 0.68
R1140:Tbc1d2b UTSW 9 90226376 missense possibly damaging 0.91
R1892:Tbc1d2b UTSW 9 90218943 missense probably damaging 0.98
R4064:Tbc1d2b UTSW 9 90218922 nonsense probably null
R4541:Tbc1d2b UTSW 9 90205169 missense probably damaging 1.00
R4590:Tbc1d2b UTSW 9 90270500 missense possibly damaging 0.81
R4651:Tbc1d2b UTSW 9 90207887 missense probably damaging 1.00
R4652:Tbc1d2b UTSW 9 90207887 missense probably damaging 1.00
R4971:Tbc1d2b UTSW 9 90218870 missense probably benign 0.00
R5086:Tbc1d2b UTSW 9 90227457 missense probably benign
R5131:Tbc1d2b UTSW 9 90209759 missense probably damaging 1.00
R5205:Tbc1d2b UTSW 9 90207810 missense probably damaging 1.00
R5502:Tbc1d2b UTSW 9 90227443 missense probably benign
R5509:Tbc1d2b UTSW 9 90218969 missense probably damaging 1.00
R5534:Tbc1d2b UTSW 9 90227506 missense possibly damaging 0.89
R5729:Tbc1d2b UTSW 9 90207872 missense probably benign 0.22
R5735:Tbc1d2b UTSW 9 90222409 missense possibly damaging 0.71
R5847:Tbc1d2b UTSW 9 90209724 missense probably damaging 1.00
R5928:Tbc1d2b UTSW 9 90219144 missense probably benign 0.13
R6766:Tbc1d2b UTSW 9 90226209 missense probably benign
R7563:Tbc1d2b UTSW 9 90219010 nonsense probably null
R7563:Tbc1d2b UTSW 9 90226248 missense probably benign
X0066:Tbc1d2b UTSW 9 90218658 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTTACAACCAGACCTCTAGGGG -3'
(R):5'- TGACAAGTATTTCACGAACCCC -3'

Sequencing Primer
(F):5'- ACCTCTAGGGGTCAGCG -3'
(R):5'- TCCTGCACCAGAAGGACGAG -3'
Posted On2018-06-22