Mutagenetix > Incidental Mutation

Incidental Mutation 'R6595:Zc3h14'

524889

Institutional Source

Beutler Lab

Gene Symbol

Zc3h14

Ensembl Gene

ENSMUSG00000021012

Gene Name

zinc finger CCCH type containing 14

Synonyms

1700016A15Rik, 1010001P15Rik, 2700069A02Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6595 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

98746964-98787753 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 98757026 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 85 (S85T)

Ref Sequence

ENSEMBL: ENSMUSP00000105732 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057000] [ENSMUST00000110104] [ENSMUST00000110105] [ENSMUST00000221532] [ENSMUST00000223083]

AlphaFold

Q8BJ05

Predicted Effect

probably damaging
Transcript: ENSMUST00000057000
AA Change: S85T

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000055879
Gene: ENSMUSG00000021012
AA Change: S85T

Domain	Start	End	E-Value	Type
low complexity region	298	306	N/A	INTRINSIC
low complexity region	313	320	N/A	INTRINSIC
ZnF_C3H1	440	463	7.16e-1	SMART
ZnF_C3H1	465	484	5.27e1	SMART
ZnF_C3H1	520	542	5.55e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000110104
AA Change: S85T

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000105731
Gene: ENSMUSG00000021012
AA Change: S85T

Domain	Start	End	E-Value	Type
low complexity region	298	306	N/A	INTRINSIC
low complexity region	313	320	N/A	INTRINSIC
ZnF_C3H1	465	488	7.16e-1	SMART
ZnF_C3H1	490	509	5.27e1	SMART
ZnF_C3H1	545	567	5.55e0	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000110105
AA Change: S85T

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000105732
Gene: ENSMUSG00000021012
AA Change: S85T

Domain	Start	End	E-Value	Type
low complexity region	298	306	N/A	INTRINSIC
low complexity region	313	320	N/A	INTRINSIC
ZnF_C3H1	596	619	7.16e-1	SMART
ZnF_C3H1	621	640	5.27e1	SMART
ZnF_C3H1	676	698	5.55e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000221532

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221576

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222461

Predicted Effect

probably benign
Transcript: ENSMUST00000223083
AA Change: S192T

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)

Predicted Effect

probably benign
Transcript: ENSMUST00000223451

Meta Mutation Damage Score

0.0711

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.5%

Validation Efficiency

97% (37/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a poly(A)-binding protein that can affect gene expression and poly(A) tail length. The encoded protein may influence mRNA stability, nuclear export, and translation. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous knockout results in impaired spatial working memory, enlarged anterior lateral ventricles in the brain, small testes and reduced litter size. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007G11Rik	A	T	5: 98,801,858	D217V	possibly damaging	Het
Abca15	A	T	7: 120,394,487	Y1310F	probably benign	Het
Ankrd54	A	G	15: 79,057,985	F148L	probably damaging	Het
Bag4	C	T	8: 25,769,500	D224N	probably damaging	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Camk2b	A	T	11: 5,992,856	H126Q	probably damaging	Het
Camsap3	G	T	8: 3,604,186	V608L	probably damaging	Het
Camsap3	A	T	8: 3,608,742	M796L	probably damaging	Het
Cdh19	T	C	1: 110,925,787	D308G	probably benign	Het
Cpsf1	T	C	15: 76,602,510	I275M	probably damaging	Het
Cuta	A	G	17: 26,938,882		probably null	Het
Dclk2	A	G	3: 86,792,067		probably benign	Het
Dst	T	G	1: 34,250,680	L784R	probably damaging	Het
Fbn1	T	C	2: 125,342,830	M1681V	possibly damaging	Het
Fbxo9	A	T	9: 78,087,212	D274E	probably damaging	Het
Frem2	T	A	3: 53,549,784	D2049V	probably damaging	Het
Fscn3	T	C	6: 28,430,175	Y115H	probably damaging	Het
Glp2r	G	T	11: 67,764,777	D46E	probably benign	Het
Gm13103	T	C	4: 143,852,756	C304R	probably damaging	Het
Gpat2	G	C	2: 127,431,918	G294R	possibly damaging	Het
Irx5	A	G	8: 92,359,619	Y110C	probably damaging	Het
Kdm5d	T	C	Y: 939,829	S994P	probably benign	Homo
Klhl2	A	T	8: 64,743,043	C555*	probably null	Het
Krtap4-7	A	T	11: 99,643,734	I101N	unknown	Het
Olfr1308	A	T	2: 111,960,170	V301E	possibly damaging	Het
Olfr60	A	G	7: 140,345,647	L114P	probably damaging	Het
Pcdhb21	T	C	18: 37,515,908	S697P	probably damaging	Het
Rasgrf2	A	T	13: 92,030,853	H237Q	probably damaging	Het
Rnf216	A	T	5: 143,090,657	D157E	probably benign	Het
Rxrg	T	A	1: 167,627,336	F163I	probably damaging	Het
Soat2	T	A	15: 102,160,593	I351N	probably damaging	Het
Srp72	C	T	5: 76,984,200	T242I	probably benign	Het
Svopl	T	C	6: 38,041,067		probably null	Het
Tbc1d2b	G	A	9: 90,226,092	P469S	probably benign	Het
Tbkbp1	G	A	11: 97,138,752		probably benign	Het
Tecta	A	G	9: 42,384,227	V324A	probably damaging	Het
Twnk	T	C	19: 45,010,492	V557A	probably damaging	Het
Vmn2r18	G	A	5: 151,562,424	T535I	probably damaging	Het

Other mutations in Zc3h14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00835:Zc3h14	APN	12	98747524	critical splice donor site	probably null
IGL00946:Zc3h14	APN	12	98759883	splice site	probably benign
IGL00969:Zc3h14	APN	12	98758843	missense	probably benign	0.00
IGL01626:Zc3h14	APN	12	98779186	missense	possibly damaging	0.72
IGL01891:Zc3h14	APN	12	98758947	unclassified	probably benign
IGL02119:Zc3h14	APN	12	98763895	missense	probably benign	0.00
IGL02484:Zc3h14	APN	12	98774301	missense	probably benign	0.14
IGL02744:Zc3h14	APN	12	98784975	missense	possibly damaging	0.67
IGL02894:Zc3h14	APN	12	98758943	critical splice donor site	probably null
R0408:Zc3h14	UTSW	12	98763823	missense	probably damaging	1.00
R0739:Zc3h14	UTSW	12	98757201	missense	probably damaging	0.99
R0865:Zc3h14	UTSW	12	98779269	critical splice donor site	probably null
R0926:Zc3h14	UTSW	12	98758590	missense	possibly damaging	0.94
R1530:Zc3h14	UTSW	12	98785003	missense	probably damaging	1.00
R1735:Zc3h14	UTSW	12	98758580	missense	probably damaging	1.00
R1743:Zc3h14	UTSW	12	98779189	missense	probably benign	0.04
R1848:Zc3h14	UTSW	12	98752832	missense	possibly damaging	0.89
R1851:Zc3h14	UTSW	12	98760354	nonsense	probably null
R1978:Zc3h14	UTSW	12	98763922	missense	probably damaging	0.97
R2011:Zc3h14	UTSW	12	98780268	missense	possibly damaging	0.76
R2198:Zc3h14	UTSW	12	98752809	missense	probably damaging	1.00
R2198:Zc3h14	UTSW	12	98752810	missense	possibly damaging	0.94
R2263:Zc3h14	UTSW	12	98758514	missense	probably benign	0.32
R3762:Zc3h14	UTSW	12	98758643	missense	probably damaging	1.00
R4210:Zc3h14	UTSW	12	98785399	missense	probably damaging	1.00
R4353:Zc3h14	UTSW	12	98763960	missense	possibly damaging	0.70
R4360:Zc3h14	UTSW	12	98780197	missense	probably benign	0.09
R4814:Zc3h14	UTSW	12	98752848	missense	probably damaging	1.00
R4815:Zc3h14	UTSW	12	98752848	missense	probably damaging	1.00
R4817:Zc3h14	UTSW	12	98752848	missense	probably damaging	1.00
R4947:Zc3h14	UTSW	12	98759824	missense	probably benign
R5077:Zc3h14	UTSW	12	98757206	critical splice donor site	probably null
R5431:Zc3h14	UTSW	12	98780065	missense	possibly damaging	0.94
R5783:Zc3h14	UTSW	12	98757175	missense	probably damaging	0.99
R5850:Zc3h14	UTSW	12	98779155	missense	probably damaging	0.97
R6034:Zc3h14	UTSW	12	98771373	missense	probably benign	0.01
R6034:Zc3h14	UTSW	12	98771373	missense	probably benign	0.01
R6291:Zc3h14	UTSW	12	98759828	missense	probably damaging	1.00
R6338:Zc3h14	UTSW	12	98758590	missense	possibly damaging	0.94
R6737:Zc3h14	UTSW	12	98785046	missense	probably damaging	1.00
R6932:Zc3h14	UTSW	12	98771077	intron	probably benign
R7074:Zc3h14	UTSW	12	98758600	missense	possibly damaging	0.96
R7204:Zc3h14	UTSW	12	98771356	missense	probably damaging	1.00
R7237:Zc3h14	UTSW	12	98780149	missense	probably benign	0.34
R7267:Zc3h14	UTSW	12	98785729	missense	probably damaging	1.00
R8753:Zc3h14	UTSW	12	98758572	missense	probably benign	0.12
R9169:Zc3h14	UTSW	12	98779246	missense	probably damaging	1.00
R9610:Zc3h14	UTSW	12	98771404	missense	possibly damaging	0.92
RF020:Zc3h14	UTSW	12	98780282	critical splice donor site	probably null
RF024:Zc3h14	UTSW	12	98758861	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCATACTCTCAGGTGCCTTTTAAAC -3'
(R):5'- TGGATTTCTGCTCCTGTGAAC -3'

Sequencing Primer
(F):5'- TGTAAGAAGCCCCAGGTTTAGTCC -3'
(R):5'- CTCCTGTGAACTTGTAGAAACTCTGG -3'

Posted On

2018-06-22