Incidental Mutation 'R6628:Cd4'
ID524907
Institutional Source Beutler Lab
Gene Symbol Cd4
Ensembl Gene ENSMUSG00000023274
Gene NameCD4 antigen
SynonymsL3T4, Ly-4
MMRRC Submission
Accession Numbers

Genbank: NM_013488; MGI: 88335

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6628 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location124864692-124888221 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124879468 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 20 (L20P)
Ref Sequence ENSEMBL: ENSMUSP00000024044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024044]
Predicted Effect unknown
Transcript: ENSMUST00000024044
AA Change: L20P
SMART Domains Protein: ENSMUSP00000024044
Gene: ENSMUSG00000023274
AA Change: L20P

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
IGv 37 114 7.02e-8 SMART
IG 131 206 3.63e-1 SMART
IG 212 317 3.36e0 SMART
transmembrane domain 394 416 N/A INTRINSIC
Pfam:Tcell_CD4_C 425 452 2.2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130378
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151594
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane glycoprotein of T lymphocytes that interacts with major histocompatibility complex class II antigenes and is also a receptor for the human immunodeficiency virus. This gene is expressed not only in T lymphocytes, but also in B cells, macrophages, and granulocytes. It is also expressed in specific regions of the brain. The protein functions to initiate or augment the early phase of T-cell activation, and may function as an important mediator of indirect neuronal damage in infectious and immune-mediated diseases of the central nervous system. Multiple alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for knock-out alleles exhibit abnormal immune system morphology and physiology. [provided by MGI curators]
Allele List at MGI

 All alleles(25) : Targeted(13) Gene trapped(6) Spontaneous(2) Chemically induced(4)          

Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 A C 16: 85,795,825 M565R probably benign Het
Chrm2 G T 6: 36,523,357 V50F probably damaging Het
Clasp2 A G 9: 113,896,720 T828A probably damaging Het
Clec4a4 A G 6: 123,012,804 K135E probably benign Het
Clmn T C 12: 104,773,786 R961G probably damaging Het
Cyp2s1 T C 7: 25,815,041 K64E probably benign Het
Dagla T C 19: 10,263,227 D213G probably damaging Het
Dsp A T 13: 38,167,622 E139V possibly damaging Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Gm7030 T C 17: 36,129,054 S63G possibly damaging Het
Gtf3c1 A T 7: 125,668,074 D928E probably benign Het
Gulo T C 14: 66,004,170 K80E probably benign Het
Kdm5d A G Y: 900,525 Y190C probably damaging Homo
Kif27 A T 13: 58,354,797 H22Q probably damaging Het
Kmt2c T C 5: 25,298,928 D383G probably benign Het
Lmtk2 A G 5: 144,174,685 E741G probably benign Het
Mphosph9 G T 5: 124,298,762 N506K probably damaging Het
Myo16 T C 8: 10,570,638 S1674P probably damaging Het
Olfr1062 T G 2: 86,423,017 N220H probably benign Het
Olfr196 T C 16: 59,167,981 H54R probably benign Het
Pdcd10 A G 3: 75,521,071 V82A probably damaging Het
Ptpn11 G T 5: 121,134,829 probably null Het
Pxdn T C 12: 29,999,918 L475P probably damaging Het
Senp6 A G 9: 80,132,954 D781G probably damaging Het
Tbc1d5 T C 17: 50,736,208 T751A probably benign Het
Tbx18 A T 9: 87,715,535 Y315* probably null Het
Wrap53 T C 11: 69,562,144 K446E probably benign Het
Wwp1 T C 4: 19,661,963 probably null Het
Other mutations in Cd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
maat APN 6 124866684 unclassified probably benign
seshat APN 6 124872977 missense possibly damaging 0.81
thoth APN 6 124873140 splice site probably benign
IGL00783:Cd4 APN 6 124872989 missense possibly damaging 0.81
IGL00784:Cd4 APN 6 124872989 missense possibly damaging 0.81
IGL01294:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01295:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01296:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01298:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01299:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01397:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01401:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01402:Cd4 APN 6 124879378 missense probably benign 0.41
IGL01407:Cd4 APN 6 124879378 missense probably benign 0.41
craw UTSW 6 124867746 nonsense probably null
Doubles UTSW 6 124872458 missense probably benign 0.01
fourless UTSW 6 124870244 critical splice donor site probably null
R0152:Cd4 UTSW 6 124867746 nonsense probably null
R0196:Cd4 UTSW 6 124867806 missense probably damaging 0.97
R1769:Cd4 UTSW 6 124866655 missense possibly damaging 0.71
R1992:Cd4 UTSW 6 124867688 missense possibly damaging 0.59
R2126:Cd4 UTSW 6 124870536 missense probably benign 0.01
R3237:Cd4 UTSW 6 124867670 missense probably benign 0.37
R3706:Cd4 UTSW 6 124879388 missense probably benign
R4535:Cd4 UTSW 6 124870451 missense probably benign 0.01
R5026:Cd4 UTSW 6 124866620 missense possibly damaging 0.95
R5084:Cd4 UTSW 6 124870439 missense probably damaging 1.00
R6772:Cd4 UTSW 6 124872458 missense probably benign 0.01
R7038:Cd4 UTSW 6 124870254 missense probably damaging 0.98
R7083:Cd4 UTSW 6 124870572 missense probably benign 0.16
R7313:Cd4 UTSW 6 124867103 missense probably benign 0.15
R7394:Cd4 UTSW 6 124873041 missense probably benign 0.00
R7943:Cd4 UTSW 6 124870244 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCATCATGGGACTTTGGGCTTC -3'
(R):5'- TGCCGAGCCATCTCTCTTAG -3'

Sequencing Primer
(F):5'- GGCTTCTAGGAATAAGGTTCATTC -3'
(R):5'- CTTAGGCGCTTGCTGCTGC -3'
Posted On2018-06-22