Incidental Mutation 'R6597:Rps6kc1'
ID524909
Institutional Source Beutler Lab
Gene Symbol Rps6kc1
Ensembl Gene ENSMUSG00000089872
Gene Nameribosomal protein S6 kinase polypeptide 1
SynonymsRPK118
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6597 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location190700202-190911770 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 190750184 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 286 (W286R)
Ref Sequence ENSEMBL: ENSMUSP00000125010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159624]
Predicted Effect probably benign
Transcript: ENSMUST00000159624
AA Change: W286R

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000125010
Gene: ENSMUSG00000089872
AA Change: W286R

DomainStartEndE-ValueType
PX 9 128 1.26e-13 SMART
low complexity region 160 175 N/A INTRINSIC
low complexity region 198 211 N/A INTRINSIC
Pfam:MIT 238 299 6.9e-13 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik G T 1: 136,226,189 A87E probably damaging Het
A2m A G 6: 121,648,121 Y486C probably damaging Het
Asb17 A T 3: 153,844,684 T118S probably damaging Het
Atl2 T A 17: 79,852,766 D293V possibly damaging Het
Bbs1 T A 19: 4,899,306 M242L probably benign Het
Btg1 T A 10: 96,618,320 S65T probably damaging Het
Cfap54 T C 10: 92,999,040 D1101G possibly damaging Het
Cmpk2 G T 12: 26,474,145 V314L possibly damaging Het
Fbxl8 A C 8: 105,268,891 D345A probably benign Het
Gys2 T A 6: 142,456,309 H268L probably benign Het
Hecw1 T A 13: 14,316,818 R117* probably null Het
Hoxd10 G A 2: 74,692,640 A221T probably benign Het
Hspa13 A T 16: 75,765,197 L38Q probably damaging Het
Ipo11 A G 13: 106,865,863 probably null Het
Itgb8 A G 12: 119,173,398 V390A possibly damaging Het
Kalrn T A 16: 34,182,747 I1370F probably damaging Het
Macf1 T C 4: 123,382,692 N6086S probably damaging Het
Ms4a13 T C 19: 11,192,939 T14A probably benign Het
Olfr1164 A G 2: 88,093,069 F289S probably damaging Het
Olfr1500 T A 19: 13,828,457 probably benign Het
Olfr204 C T 16: 59,315,350 R19H probably benign Het
Olfr545 A T 7: 102,494,421 I118N probably damaging Het
Olfr742 T A 14: 50,515,551 C116S probably benign Het
Olfr911-ps1 A T 9: 38,524,004 I91F probably benign Het
Patl2 T A 2: 122,186,164 probably benign Het
Pcdhga7 T C 18: 37,717,006 S689P probably benign Het
Pitpnc1 G T 11: 107,226,232 Y227* probably null Het
Pla2g2e T C 4: 138,880,673 V22A unknown Het
Ppil1 C A 17: 29,261,878 V24F probably benign Het
Prl3b1 G A 13: 27,247,974 probably null Het
Rabgef1 G A 5: 130,191,044 probably null Het
Rhot2 A T 17: 25,840,912 W341R probably damaging Het
Rrs1 A G 1: 9,546,376 T285A probably damaging Het
Shc3 T A 13: 51,442,973 D338V possibly damaging Het
Siglech A T 7: 55,768,463 M60L probably benign Het
Slc12a6 G T 2: 112,352,935 V756F probably damaging Het
Slc43a2 G A 11: 75,571,855 G507D probably damaging Het
Slf1 A G 13: 77,049,129 S789P probably benign Het
Spata31d1d C A 13: 59,726,057 M1221I probably benign Het
Srgap1 T C 10: 121,792,371 N899D probably benign Het
Stag1 G A 9: 100,887,420 M529I probably benign Het
Tekt3 A G 11: 63,081,259 D247G probably benign Het
Tmppe A T 9: 114,405,244 M204L probably benign Het
Tpsg1 G A 17: 25,369,297 probably benign Het
Ttn A G 2: 76,797,971 V6288A probably benign Het
Ttn A T 2: 76,893,100 probably benign Het
Twsg1 C A 17: 65,937,804 V73F probably damaging Het
Vmn2r102 A G 17: 19,694,188 T672A probably damaging Het
Vps36 A G 8: 22,202,304 I66V probably benign Het
Xrcc4 A T 13: 90,000,929 D157E probably benign Het
Zbbx T A 3: 75,136,454 Q162L probably damaging Het
Zfp560 T A 9: 20,348,001 I522L probably benign Het
Zscan20 T C 4: 128,585,746 N984S probably damaging Het
Other mutations in Rps6kc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01296:Rps6kc1 APN 1 190773678 missense probably damaging 1.00
IGL01310:Rps6kc1 APN 1 190783625 missense probably benign 0.45
IGL01331:Rps6kc1 APN 1 190800352 missense possibly damaging 0.49
IGL01551:Rps6kc1 APN 1 190773640 missense possibly damaging 0.70
IGL01665:Rps6kc1 APN 1 190911657 missense possibly damaging 0.66
IGL02178:Rps6kc1 APN 1 190871836 missense possibly damaging 0.63
IGL02550:Rps6kc1 APN 1 190871862 missense probably damaging 1.00
IGL02986:Rps6kc1 APN 1 190834061 missense probably damaging 1.00
IGL03010:Rps6kc1 APN 1 190911606 nonsense probably null
IGL03087:Rps6kc1 APN 1 190871711 missense probably damaging 1.00
IGL03130:Rps6kc1 APN 1 190799811 missense probably damaging 1.00
IGL03264:Rps6kc1 APN 1 190871829 missense probably benign
IGL03386:Rps6kc1 APN 1 190799570 missense probably damaging 0.97
R0184:Rps6kc1 UTSW 1 190799093 missense probably null 1.00
R0280:Rps6kc1 UTSW 1 190809000 missense probably damaging 1.00
R0482:Rps6kc1 UTSW 1 190799430 missense probably benign 0.00
R0651:Rps6kc1 UTSW 1 190799496 missense possibly damaging 0.51
R0785:Rps6kc1 UTSW 1 190808945 missense probably damaging 1.00
R1398:Rps6kc1 UTSW 1 190800015 missense probably damaging 0.99
R1428:Rps6kc1 UTSW 1 190798726 missense probably damaging 1.00
R1484:Rps6kc1 UTSW 1 190799475 missense possibly damaging 0.63
R1536:Rps6kc1 UTSW 1 190871768 missense possibly damaging 0.89
R1709:Rps6kc1 UTSW 1 190800336 missense possibly damaging 0.72
R2060:Rps6kc1 UTSW 1 190810108 missense possibly damaging 0.94
R2153:Rps6kc1 UTSW 1 190798723 missense probably damaging 1.00
R2871:Rps6kc1 UTSW 1 190899569 missense probably damaging 1.00
R2871:Rps6kc1 UTSW 1 190899569 missense probably damaging 1.00
R4177:Rps6kc1 UTSW 1 190800419 missense possibly damaging 0.92
R4231:Rps6kc1 UTSW 1 190808900 missense probably damaging 1.00
R4401:Rps6kc1 UTSW 1 190799958 missense probably benign 0.32
R4402:Rps6kc1 UTSW 1 190798605 intron probably benign
R4785:Rps6kc1 UTSW 1 190750188 missense probably benign 0.00
R4810:Rps6kc1 UTSW 1 190808963 missense probably damaging 1.00
R4858:Rps6kc1 UTSW 1 190800318 missense probably damaging 1.00
R4887:Rps6kc1 UTSW 1 190798694 missense probably benign 0.13
R4976:Rps6kc1 UTSW 1 190798727 missense probably damaging 0.99
R5134:Rps6kc1 UTSW 1 190773648 missense probably damaging 1.00
R5217:Rps6kc1 UTSW 1 190783605 missense probably damaging 1.00
R5350:Rps6kc1 UTSW 1 190799466 missense probably benign
R5952:Rps6kc1 UTSW 1 190885420 missense probably benign 0.05
R5979:Rps6kc1 UTSW 1 190800435 missense probably damaging 1.00
R7024:Rps6kc1 UTSW 1 190800210 missense probably benign 0.00
R7192:Rps6kc1 UTSW 1 190800359 missense probably damaging 0.98
R7423:Rps6kc1 UTSW 1 190799096 missense probably damaging 1.00
R7493:Rps6kc1 UTSW 1 190800057 missense probably benign 0.26
R7718:Rps6kc1 UTSW 1 190871825 missense probably benign 0.13
R7783:Rps6kc1 UTSW 1 190773654 missense probably benign 0.39
R7794:Rps6kc1 UTSW 1 190783628 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GGGTTGCCAGTGAATCTGAGA -3'
(R):5'- CCTGATGGTGGGGAGTGTCC -3'

Sequencing Primer
(F):5'- TTGCCAGTGAATCTGAGATAGAGAC -3'
(R):5'- ATGGTGGGGAGTGTCCTGATG -3'
Posted On2018-06-22