Incidental Mutation 'R6628:Cyp2s1'
ID524910
Institutional Source Beutler Lab
Gene Symbol Cyp2s1
Ensembl Gene ENSMUSG00000040703
Gene Namecytochrome P450, family 2, subfamily s, polypeptide 1
Synonyms1200011C15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6628 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location25802475-25816913 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25815041 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 64 (K64E)
Ref Sequence ENSEMBL: ENSMUSP00000104032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043314] [ENSMUST00000108395] [ENSMUST00000156714]
Predicted Effect probably benign
Transcript: ENSMUST00000043314
AA Change: K64E

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000041175
Gene: ENSMUSG00000040703
AA Change: K64E

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:p450 34 493 6.4e-122 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108395
AA Change: K64E

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000104032
Gene: ENSMUSG00000040703
AA Change: K64E

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:p450 34 440 4e-108 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152560
Predicted Effect probably benign
Transcript: ENSMUST00000156714
SMART Domains Protein: ENSMUSP00000122264
Gene: ENSMUSG00000040703

DomainStartEndE-ValueType
Pfam:p450 1 91 1.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206602
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. In rodents, the homologous protein has been shown to metabolize certain carcinogens; however, the specific function of the human protein has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and appear normal in terms of body weight, growth rate, organ weight, and daily activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts1 A C 16: 85,795,825 M565R probably benign Het
Cd4 A G 6: 124,879,468 L20P unknown Het
Chrm2 G T 6: 36,523,357 V50F probably damaging Het
Clasp2 A G 9: 113,896,720 T828A probably damaging Het
Clec4a4 A G 6: 123,012,804 K135E probably benign Het
Clmn T C 12: 104,773,786 R961G probably damaging Het
Dagla T C 19: 10,263,227 D213G probably damaging Het
Dsp A T 13: 38,167,622 E139V possibly damaging Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Gm7030 T C 17: 36,129,054 S63G possibly damaging Het
Gtf3c1 A T 7: 125,668,074 D928E probably benign Het
Gulo T C 14: 66,004,170 K80E probably benign Het
Kdm5d A G Y: 900,525 Y190C probably damaging Homo
Kif27 A T 13: 58,354,797 H22Q probably damaging Het
Kmt2c T C 5: 25,298,928 D383G probably benign Het
Lmtk2 A G 5: 144,174,685 E741G probably benign Het
Mphosph9 G T 5: 124,298,762 N506K probably damaging Het
Myo16 T C 8: 10,570,638 S1674P probably damaging Het
Olfr1062 T G 2: 86,423,017 N220H probably benign Het
Olfr196 T C 16: 59,167,981 H54R probably benign Het
Pdcd10 A G 3: 75,521,071 V82A probably damaging Het
Ptpn11 G T 5: 121,134,829 probably null Het
Pxdn T C 12: 29,999,918 L475P probably damaging Het
Senp6 A G 9: 80,132,954 D781G probably damaging Het
Tbc1d5 T C 17: 50,736,208 T751A probably benign Het
Tbx18 A T 9: 87,715,535 Y315* probably null Het
Wrap53 T C 11: 69,562,144 K446E probably benign Het
Wwp1 T C 4: 19,661,963 probably null Het
Other mutations in Cyp2s1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Cyp2s1 APN 7 25809258 missense probably damaging 1.00
IGL02415:Cyp2s1 APN 7 25808137 missense probably damaging 1.00
IGL02530:Cyp2s1 APN 7 25816424 unclassified probably benign
IGL02927:Cyp2s1 APN 7 25808152 missense probably benign 0.17
IGL03358:Cyp2s1 APN 7 25808148 missense probably damaging 1.00
R0139:Cyp2s1 UTSW 7 25811689 utr 5 prime probably null
R0523:Cyp2s1 UTSW 7 25806050 missense probably damaging 1.00
R0650:Cyp2s1 UTSW 7 25809258 missense probably damaging 1.00
R0652:Cyp2s1 UTSW 7 25809258 missense probably damaging 1.00
R0723:Cyp2s1 UTSW 7 25809548 missense probably benign 0.01
R1086:Cyp2s1 UTSW 7 25805997 missense probably damaging 1.00
R3732:Cyp2s1 UTSW 7 25803954 missense probably null 0.08
R3732:Cyp2s1 UTSW 7 25803954 missense probably null 0.08
R3733:Cyp2s1 UTSW 7 25803954 missense probably null 0.08
R3813:Cyp2s1 UTSW 7 25805866 splice site probably null
R3958:Cyp2s1 UTSW 7 25803954 missense probably null 0.08
R4593:Cyp2s1 UTSW 7 25816442 unclassified probably benign
R4965:Cyp2s1 UTSW 7 25809285 missense possibly damaging 0.85
R5278:Cyp2s1 UTSW 7 25805884 missense possibly damaging 0.95
R5642:Cyp2s1 UTSW 7 25816319 splice site probably null
R6258:Cyp2s1 UTSW 7 25816442 unclassified probably benign
R6762:Cyp2s1 UTSW 7 25808070 missense probably damaging 1.00
R7367:Cyp2s1 UTSW 7 25805973 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGGCACTCAGTCACCTGTAC -3'
(R):5'- AGAGAGCAGCTTCCCAAAG -3'

Sequencing Primer
(F):5'- AAAGCTCCAGACCTGCAGTGG -3'
(R):5'- CAAAGGGATGCTTTGGATTGG -3'
Posted On2018-06-22