Mutagenetix > Incidental Mutations

Incidental Mutation 'R6597:Zbbx'

524920

Institutional Source

Beutler Lab

Gene Symbol

Zbbx

Ensembl Gene

ENSMUSG00000034151

Gene Name

zinc finger, B-box domain containing

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R6597 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

75037907-75165034 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 75136454 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 162 (Q162L)

Ref Sequence

ENSEMBL: ENSMUSP00000122459 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039269] [ENSMUST00000107775] [ENSMUST00000107776] [ENSMUST00000107778] [ENSMUST00000124618]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039269
AA Change: Q46L

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000043970
Gene: ENSMUSG00000034151
AA Change: Q46L

Domain	Start	End	E-Value	Type
Blast:BBOX	13	58	5e-22	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107775
AA Change: Q46L

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000103404
Gene: ENSMUSG00000034151
AA Change: Q46L

Domain	Start	End	E-Value	Type
Pfam:zf-B_box	12	58	3.9e-7	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000107776
AA Change: Q46L

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000103405
Gene: ENSMUSG00000034151
AA Change: Q46L

Domain	Start	End	E-Value	Type
Blast:BBOX	13	58	1e-21	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107778
AA Change: Q46L

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000103407
Gene: ENSMUSG00000034151
AA Change: Q46L

Domain	Start	End	E-Value	Type
Blast:BBOX	13	58	5e-22	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000124618
AA Change: Q162L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000122459
Gene: ENSMUSG00000034151
AA Change: Q162L

Domain	Start	End	E-Value	Type
coiled coil region	23	60	N/A	INTRINSIC
Pfam:zf-B_box	128	174	1.3e-7	PFAM

Meta Mutation Damage Score

0.3423

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.2%

Validation Efficiency

100% (50/50)

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730559C18Rik	G	T	1: 136,226,189	A87E	probably damaging	Het
A2m	A	G	6: 121,648,121	Y486C	probably damaging	Het
Asb17	A	T	3: 153,844,684	T118S	probably damaging	Het
Atl2	T	A	17: 79,852,766	D293V	possibly damaging	Het
Bbs1	T	A	19: 4,899,306	M242L	probably benign	Het
Btg1	T	A	10: 96,618,320	S65T	probably damaging	Het
Cfap54	T	C	10: 92,999,040	D1101G	possibly damaging	Het
Cmpk2	G	T	12: 26,474,145	V314L	possibly damaging	Het
Fbxl8	A	C	8: 105,268,891	D345A	probably benign	Het
Gys2	T	A	6: 142,456,309	H268L	probably benign	Het
Hecw1	T	A	13: 14,316,818	R117*	probably null	Het
Hoxd10	G	A	2: 74,692,640	A221T	probably benign	Het
Hspa13	A	T	16: 75,765,197	L38Q	probably damaging	Het
Ipo11	A	G	13: 106,865,863		probably null	Het
Itgb8	A	G	12: 119,173,398	V390A	possibly damaging	Het
Kalrn	T	A	16: 34,182,747	I1370F	probably damaging	Het
Macf1	T	C	4: 123,382,692	N6086S	probably damaging	Het
Ms4a13	T	C	19: 11,192,939	T14A	probably benign	Het
Olfr1164	A	G	2: 88,093,069	F289S	probably damaging	Het
Olfr1500	T	A	19: 13,828,457		probably benign	Het
Olfr204	C	T	16: 59,315,350	R19H	probably benign	Het
Olfr545	A	T	7: 102,494,421	I118N	probably damaging	Het
Olfr742	T	A	14: 50,515,551	C116S	probably benign	Het
Olfr911-ps1	A	T	9: 38,524,004	I91F	probably benign	Het
Patl2	T	A	2: 122,186,164		probably benign	Het
Pcdhga7	T	C	18: 37,717,006	S689P	probably benign	Het
Pitpnc1	G	T	11: 107,226,232	Y227*	probably null	Het
Pla2g2e	T	C	4: 138,880,673	V22A	unknown	Het
Ppil1	C	A	17: 29,261,878	V24F	probably benign	Het
Prl3b1	G	A	13: 27,247,974		probably null	Het
Rabgef1	G	A	5: 130,191,044		probably null	Het
Rhot2	A	T	17: 25,840,912	W341R	probably damaging	Het
Rps6kc1	A	T	1: 190,750,184	W286R	probably benign	Het
Rrs1	A	G	1: 9,546,376	T285A	probably damaging	Het
Shc3	T	A	13: 51,442,973	D338V	possibly damaging	Het
Siglech	A	T	7: 55,768,463	M60L	probably benign	Het
Slc12a6	G	T	2: 112,352,935	V756F	probably damaging	Het
Slc43a2	G	A	11: 75,571,855	G507D	probably damaging	Het
Slf1	A	G	13: 77,049,129	S789P	probably benign	Het
Spata31d1d	C	A	13: 59,726,057	M1221I	probably benign	Het
Srgap1	T	C	10: 121,792,371	N899D	probably benign	Het
Stag1	G	A	9: 100,887,420	M529I	probably benign	Het
Tekt3	A	G	11: 63,081,259	D247G	probably benign	Het
Tmppe	A	T	9: 114,405,244	M204L	probably benign	Het
Tpsg1	G	A	17: 25,369,297		probably benign	Het
Ttn	A	G	2: 76,797,971	V6288A	probably benign	Het
Ttn	A	T	2: 76,893,100		probably benign	Het
Twsg1	C	A	17: 65,937,804	V73F	probably damaging	Het
Vmn2r102	A	G	17: 19,694,188	T672A	probably damaging	Het
Vps36	A	G	8: 22,202,304	I66V	probably benign	Het
Xrcc4	A	T	13: 90,000,929	D157E	probably benign	Het
Zfp560	T	A	9: 20,348,001	I522L	probably benign	Het
Zscan20	T	C	4: 128,585,746	N984S	probably damaging	Het

Other mutations in Zbbx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00561:Zbbx	APN	3	75061532	critical splice donor site	probably null
IGL01328:Zbbx	APN	3	75093075	nonsense	probably null
IGL01340:Zbbx	APN	3	75105650	missense	possibly damaging	0.53
IGL01631:Zbbx	APN	3	75078677	missense	probably damaging	0.99
IGL01681:Zbbx	APN	3	75052478	missense	probably damaging	1.00
IGL02427:Zbbx	APN	3	75139598	missense	probably benign	0.04
IGL03077:Zbbx	APN	3	75081846	missense	possibly damaging	0.61
IGL03115:Zbbx	APN	3	75078560	missense	probably benign	0.03
IGL03162:Zbbx	APN	3	75071623	splice site	probably benign
Eland	UTSW	3	75071712	missense	probably benign	0.01
PIT4480001:Zbbx	UTSW	3	75136487	missense	probably damaging	1.00
PIT4495001:Zbbx	UTSW	3	75061637	missense	probably damaging	1.00
R0179:Zbbx	UTSW	3	75085562	splice site	probably benign
R0396:Zbbx	UTSW	3	75078495	missense	possibly damaging	0.81
R0523:Zbbx	UTSW	3	75081858	missense	probably benign	0.03
R0603:Zbbx	UTSW	3	75078450	missense	probably benign	0.05
R0745:Zbbx	UTSW	3	75155427	missense	probably damaging	1.00
R0747:Zbbx	UTSW	3	75155427	missense	probably damaging	1.00
R1208:Zbbx	UTSW	3	75037992	missense	possibly damaging	0.94
R1208:Zbbx	UTSW	3	75037992	missense	possibly damaging	0.94
R1371:Zbbx	UTSW	3	75052477	missense	possibly damaging	0.58
R1769:Zbbx	UTSW	3	75083619	splice site	probably benign
R1906:Zbbx	UTSW	3	75071740	missense	probably damaging	1.00
R2069:Zbbx	UTSW	3	75078412	missense	probably benign	0.01
R2165:Zbbx	UTSW	3	75112107	missense	probably damaging	0.99
R2174:Zbbx	UTSW	3	75052414	missense	possibly damaging	0.93
R2979:Zbbx	UTSW	3	75078486	nonsense	probably null
R3121:Zbbx	UTSW	3	75081846	missense	possibly damaging	0.88
R3755:Zbbx	UTSW	3	75105671	missense	probably damaging	1.00
R3756:Zbbx	UTSW	3	75105671	missense	probably damaging	1.00
R3816:Zbbx	UTSW	3	75085495	missense	probably benign	0.00
R4002:Zbbx	UTSW	3	75105671	missense	probably damaging	1.00
R4003:Zbbx	UTSW	3	75105671	missense	probably damaging	1.00
R4057:Zbbx	UTSW	3	75105671	missense	probably damaging	1.00
R4072:Zbbx	UTSW	3	75105671	missense	probably damaging	1.00
R4073:Zbbx	UTSW	3	75105671	missense	probably damaging	1.00
R4075:Zbbx	UTSW	3	75105671	missense	probably damaging	1.00
R4114:Zbbx	UTSW	3	75139598	missense	probably benign	0.04
R4784:Zbbx	UTSW	3	75085041	missense	probably benign	0.05
R4821:Zbbx	UTSW	3	75081747	missense	possibly damaging	0.68
R5008:Zbbx	UTSW	3	75151448	missense	possibly damaging	0.62
R5030:Zbbx	UTSW	3	75083683	missense	possibly damaging	0.83
R5388:Zbbx	UTSW	3	75083670	missense	probably damaging	0.98
R6398:Zbbx	UTSW	3	75078565	missense	probably damaging	0.96
R6462:Zbbx	UTSW	3	75078659	missense	probably benign	0.07
R6882:Zbbx	UTSW	3	75071712	missense	probably benign	0.01
R7084:Zbbx	UTSW	3	75139546	missense	possibly damaging	0.92
R7096:Zbbx	UTSW	3	75081737	missense	probably benign	0.03
R7102:Zbbx	UTSW	3	75112094	missense	probably benign	0.06
R7256:Zbbx	UTSW	3	75039898	missense	probably benign	0.02
R7537:Zbbx	UTSW	3	75085519	missense	probably damaging	1.00
R7836:Zbbx	UTSW	3	75078474	missense	possibly damaging	0.65
R7905:Zbbx	UTSW	3	75085513	missense	probably benign	0.23
R7919:Zbbx	UTSW	3	75078474	missense	possibly damaging	0.65
R7988:Zbbx	UTSW	3	75085513	missense	probably benign	0.23
Z1177:Zbbx	UTSW	3	75071783	critical splice acceptor site	probably null
Z1177:Zbbx	UTSW	3	75105684	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GGCTTATCTACATAACAGTGCAGG -3'
(R):5'- ATCCAGTGACATTTGTAGTTTGAGG -3'

Sequencing Primer
(F):5'- CTACATAACAGTGCAGGAAGATGTAC -3'
(R):5'- GGATAAATATGAAGACAGGAACACC -3'

Posted On

2018-06-22