Incidental Mutation 'R6597:Zbbx'
ID524920
Institutional Source Beutler Lab
Gene Symbol Zbbx
Ensembl Gene ENSMUSG00000034151
Gene Namezinc finger, B-box domain containing
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R6597 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location75037907-75165034 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75136454 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 162 (Q162L)
Ref Sequence ENSEMBL: ENSMUSP00000122459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039269] [ENSMUST00000107775] [ENSMUST00000107776] [ENSMUST00000107778] [ENSMUST00000124618]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039269
AA Change: Q46L

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000043970
Gene: ENSMUSG00000034151
AA Change: Q46L

DomainStartEndE-ValueType
Blast:BBOX 13 58 5e-22 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000107775
AA Change: Q46L

PolyPhen 2 Score 0.822 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103404
Gene: ENSMUSG00000034151
AA Change: Q46L

DomainStartEndE-ValueType
Pfam:zf-B_box 12 58 3.9e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107776
AA Change: Q46L

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103405
Gene: ENSMUSG00000034151
AA Change: Q46L

DomainStartEndE-ValueType
Blast:BBOX 13 58 1e-21 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000107778
AA Change: Q46L

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103407
Gene: ENSMUSG00000034151
AA Change: Q46L

DomainStartEndE-ValueType
Blast:BBOX 13 58 5e-22 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000124618
AA Change: Q162L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122459
Gene: ENSMUSG00000034151
AA Change: Q162L

DomainStartEndE-ValueType
coiled coil region 23 60 N/A INTRINSIC
Pfam:zf-B_box 128 174 1.3e-7 PFAM
Meta Mutation Damage Score 0.3423 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik G T 1: 136,226,189 A87E probably damaging Het
A2m A G 6: 121,648,121 Y486C probably damaging Het
Asb17 A T 3: 153,844,684 T118S probably damaging Het
Atl2 T A 17: 79,852,766 D293V possibly damaging Het
Bbs1 T A 19: 4,899,306 M242L probably benign Het
Btg1 T A 10: 96,618,320 S65T probably damaging Het
Cfap54 T C 10: 92,999,040 D1101G possibly damaging Het
Cmpk2 G T 12: 26,474,145 V314L possibly damaging Het
Fbxl8 A C 8: 105,268,891 D345A probably benign Het
Gys2 T A 6: 142,456,309 H268L probably benign Het
Hecw1 T A 13: 14,316,818 R117* probably null Het
Hoxd10 G A 2: 74,692,640 A221T probably benign Het
Hspa13 A T 16: 75,765,197 L38Q probably damaging Het
Ipo11 A G 13: 106,865,863 probably null Het
Itgb8 A G 12: 119,173,398 V390A possibly damaging Het
Kalrn T A 16: 34,182,747 I1370F probably damaging Het
Macf1 T C 4: 123,382,692 N6086S probably damaging Het
Ms4a13 T C 19: 11,192,939 T14A probably benign Het
Olfr1164 A G 2: 88,093,069 F289S probably damaging Het
Olfr1500 T A 19: 13,828,457 probably benign Het
Olfr204 C T 16: 59,315,350 R19H probably benign Het
Olfr545 A T 7: 102,494,421 I118N probably damaging Het
Olfr742 T A 14: 50,515,551 C116S probably benign Het
Olfr911-ps1 A T 9: 38,524,004 I91F probably benign Het
Patl2 T A 2: 122,186,164 probably benign Het
Pcdhga7 T C 18: 37,717,006 S689P probably benign Het
Pitpnc1 G T 11: 107,226,232 Y227* probably null Het
Pla2g2e T C 4: 138,880,673 V22A unknown Het
Ppil1 C A 17: 29,261,878 V24F probably benign Het
Prl3b1 G A 13: 27,247,974 probably null Het
Rabgef1 G A 5: 130,191,044 probably null Het
Rhot2 A T 17: 25,840,912 W341R probably damaging Het
Rps6kc1 A T 1: 190,750,184 W286R probably benign Het
Rrs1 A G 1: 9,546,376 T285A probably damaging Het
Shc3 T A 13: 51,442,973 D338V possibly damaging Het
Siglech A T 7: 55,768,463 M60L probably benign Het
Slc12a6 G T 2: 112,352,935 V756F probably damaging Het
Slc43a2 G A 11: 75,571,855 G507D probably damaging Het
Slf1 A G 13: 77,049,129 S789P probably benign Het
Spata31d1d C A 13: 59,726,057 M1221I probably benign Het
Srgap1 T C 10: 121,792,371 N899D probably benign Het
Stag1 G A 9: 100,887,420 M529I probably benign Het
Tekt3 A G 11: 63,081,259 D247G probably benign Het
Tmppe A T 9: 114,405,244 M204L probably benign Het
Tpsg1 G A 17: 25,369,297 probably benign Het
Ttn A G 2: 76,797,971 V6288A probably benign Het
Ttn A T 2: 76,893,100 probably benign Het
Twsg1 C A 17: 65,937,804 V73F probably damaging Het
Vmn2r102 A G 17: 19,694,188 T672A probably damaging Het
Vps36 A G 8: 22,202,304 I66V probably benign Het
Xrcc4 A T 13: 90,000,929 D157E probably benign Het
Zfp560 T A 9: 20,348,001 I522L probably benign Het
Zscan20 T C 4: 128,585,746 N984S probably damaging Het
Other mutations in Zbbx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Zbbx APN 3 75061532 critical splice donor site probably null
IGL01328:Zbbx APN 3 75093075 nonsense probably null
IGL01340:Zbbx APN 3 75105650 missense possibly damaging 0.53
IGL01631:Zbbx APN 3 75078677 missense probably damaging 0.99
IGL01681:Zbbx APN 3 75052478 missense probably damaging 1.00
IGL02427:Zbbx APN 3 75139598 missense probably benign 0.04
IGL03077:Zbbx APN 3 75081846 missense possibly damaging 0.61
IGL03115:Zbbx APN 3 75078560 missense probably benign 0.03
IGL03162:Zbbx APN 3 75071623 splice site probably benign
Eland UTSW 3 75071712 missense probably benign 0.01
PIT4480001:Zbbx UTSW 3 75136487 missense probably damaging 1.00
PIT4495001:Zbbx UTSW 3 75061637 missense probably damaging 1.00
R0179:Zbbx UTSW 3 75085562 splice site probably benign
R0396:Zbbx UTSW 3 75078495 missense possibly damaging 0.81
R0523:Zbbx UTSW 3 75081858 missense probably benign 0.03
R0603:Zbbx UTSW 3 75078450 missense probably benign 0.05
R0745:Zbbx UTSW 3 75155427 missense probably damaging 1.00
R0747:Zbbx UTSW 3 75155427 missense probably damaging 1.00
R1208:Zbbx UTSW 3 75037992 missense possibly damaging 0.94
R1208:Zbbx UTSW 3 75037992 missense possibly damaging 0.94
R1371:Zbbx UTSW 3 75052477 missense possibly damaging 0.58
R1769:Zbbx UTSW 3 75083619 splice site probably benign
R1906:Zbbx UTSW 3 75071740 missense probably damaging 1.00
R2069:Zbbx UTSW 3 75078412 missense probably benign 0.01
R2165:Zbbx UTSW 3 75112107 missense probably damaging 0.99
R2174:Zbbx UTSW 3 75052414 missense possibly damaging 0.93
R2979:Zbbx UTSW 3 75078486 nonsense probably null
R3121:Zbbx UTSW 3 75081846 missense possibly damaging 0.88
R3755:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R3756:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R3816:Zbbx UTSW 3 75085495 missense probably benign 0.00
R4002:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4003:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4057:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4072:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4073:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4075:Zbbx UTSW 3 75105671 missense probably damaging 1.00
R4114:Zbbx UTSW 3 75139598 missense probably benign 0.04
R4784:Zbbx UTSW 3 75085041 missense probably benign 0.05
R4821:Zbbx UTSW 3 75081747 missense possibly damaging 0.68
R5008:Zbbx UTSW 3 75151448 missense possibly damaging 0.62
R5030:Zbbx UTSW 3 75083683 missense possibly damaging 0.83
R5388:Zbbx UTSW 3 75083670 missense probably damaging 0.98
R6398:Zbbx UTSW 3 75078565 missense probably damaging 0.96
R6462:Zbbx UTSW 3 75078659 missense probably benign 0.07
R6882:Zbbx UTSW 3 75071712 missense probably benign 0.01
R7084:Zbbx UTSW 3 75139546 missense possibly damaging 0.92
R7096:Zbbx UTSW 3 75081737 missense probably benign 0.03
R7102:Zbbx UTSW 3 75112094 missense probably benign 0.06
R7256:Zbbx UTSW 3 75039898 missense probably benign 0.02
R7537:Zbbx UTSW 3 75085519 missense probably damaging 1.00
R7836:Zbbx UTSW 3 75078474 missense possibly damaging 0.65
R7905:Zbbx UTSW 3 75085513 missense probably benign 0.23
R7919:Zbbx UTSW 3 75078474 missense possibly damaging 0.65
R7988:Zbbx UTSW 3 75085513 missense probably benign 0.23
Z1177:Zbbx UTSW 3 75071783 critical splice acceptor site probably null
Z1177:Zbbx UTSW 3 75105684 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGCTTATCTACATAACAGTGCAGG -3'
(R):5'- ATCCAGTGACATTTGTAGTTTGAGG -3'

Sequencing Primer
(F):5'- CTACATAACAGTGCAGGAAGATGTAC -3'
(R):5'- GGATAAATATGAAGACAGGAACACC -3'
Posted On2018-06-22