Incidental Mutation 'R6597:Zscan20'
ID524923
Institutional Source Beutler Lab
Gene Symbol Zscan20
Ensembl Gene ENSMUSG00000061894
Gene Namezinc finger and SCAN domains 20
SynonymsZfp31
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.259) question?
Stock #R6597 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location128583539-128610098 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128585746 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 984 (N984S)
Ref Sequence ENSEMBL: ENSMUSP00000095487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097877] [ENSMUST00000135309]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084276
Predicted Effect probably damaging
Transcript: ENSMUST00000097877
AA Change: N984S

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095487
Gene: ENSMUSG00000061894
AA Change: N984S

DomainStartEndE-ValueType
SCAN 41 147 1.31e-54 SMART
low complexity region 275 284 N/A INTRINSIC
SANT 314 378 8.04e-1 SMART
SANT 475 539 4.85e-3 SMART
ZnF_C2H2 725 747 2.61e1 SMART
ZnF_C2H2 753 775 9.88e-5 SMART
ZnF_C2H2 781 803 1.12e-3 SMART
ZnF_C2H2 862 884 3.21e-4 SMART
ZnF_C2H2 890 912 1.04e-3 SMART
ZnF_C2H2 918 940 1.56e-2 SMART
ZnF_C2H2 946 968 2.84e-5 SMART
ZnF_C2H2 974 996 4.54e-4 SMART
ZnF_C2H2 1002 1024 1.47e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135309
SMART Domains Protein: ENSMUSP00000119338
Gene: ENSMUSG00000061894

DomainStartEndE-ValueType
SCAN 41 147 1.31e-54 SMART
low complexity region 279 293 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik G T 1: 136,226,189 A87E probably damaging Het
A2m A G 6: 121,648,121 Y486C probably damaging Het
Asb17 A T 3: 153,844,684 T118S probably damaging Het
Atl2 T A 17: 79,852,766 D293V possibly damaging Het
Bbs1 T A 19: 4,899,306 M242L probably benign Het
Btg1 T A 10: 96,618,320 S65T probably damaging Het
Cfap54 T C 10: 92,999,040 D1101G possibly damaging Het
Cmpk2 G T 12: 26,474,145 V314L possibly damaging Het
Fbxl8 A C 8: 105,268,891 D345A probably benign Het
Gys2 T A 6: 142,456,309 H268L probably benign Het
Hecw1 T A 13: 14,316,818 R117* probably null Het
Hoxd10 G A 2: 74,692,640 A221T probably benign Het
Hspa13 A T 16: 75,765,197 L38Q probably damaging Het
Ipo11 A G 13: 106,865,863 probably null Het
Itgb8 A G 12: 119,173,398 V390A possibly damaging Het
Kalrn T A 16: 34,182,747 I1370F probably damaging Het
Macf1 T C 4: 123,382,692 N6086S probably damaging Het
Ms4a13 T C 19: 11,192,939 T14A probably benign Het
Olfr1164 A G 2: 88,093,069 F289S probably damaging Het
Olfr1500 T A 19: 13,828,457 probably benign Het
Olfr204 C T 16: 59,315,350 R19H probably benign Het
Olfr545 A T 7: 102,494,421 I118N probably damaging Het
Olfr742 T A 14: 50,515,551 C116S probably benign Het
Olfr911-ps1 A T 9: 38,524,004 I91F probably benign Het
Patl2 T A 2: 122,186,164 probably benign Het
Pcdhga7 T C 18: 37,717,006 S689P probably benign Het
Pitpnc1 G T 11: 107,226,232 Y227* probably null Het
Pla2g2e T C 4: 138,880,673 V22A unknown Het
Ppil1 C A 17: 29,261,878 V24F probably benign Het
Prl3b1 G A 13: 27,247,974 probably null Het
Rabgef1 G A 5: 130,191,044 probably null Het
Rhot2 A T 17: 25,840,912 W341R probably damaging Het
Rps6kc1 A T 1: 190,750,184 W286R probably benign Het
Rrs1 A G 1: 9,546,376 T285A probably damaging Het
Shc3 T A 13: 51,442,973 D338V possibly damaging Het
Siglech A T 7: 55,768,463 M60L probably benign Het
Slc12a6 G T 2: 112,352,935 V756F probably damaging Het
Slc43a2 G A 11: 75,571,855 G507D probably damaging Het
Slf1 A G 13: 77,049,129 S789P probably benign Het
Spata31d1d C A 13: 59,726,057 M1221I probably benign Het
Srgap1 T C 10: 121,792,371 N899D probably benign Het
Stag1 G A 9: 100,887,420 M529I probably benign Het
Tekt3 A G 11: 63,081,259 D247G probably benign Het
Tmppe A T 9: 114,405,244 M204L probably benign Het
Tpsg1 G A 17: 25,369,297 probably benign Het
Ttn A G 2: 76,797,971 V6288A probably benign Het
Ttn A T 2: 76,893,100 probably benign Het
Twsg1 C A 17: 65,937,804 V73F probably damaging Het
Vmn2r102 A G 17: 19,694,188 T672A probably damaging Het
Vps36 A G 8: 22,202,304 I66V probably benign Het
Xrcc4 A T 13: 90,000,929 D157E probably benign Het
Zbbx T A 3: 75,136,454 Q162L probably damaging Het
Zfp560 T A 9: 20,348,001 I522L probably benign Het
Other mutations in Zscan20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Zscan20 APN 4 128586635 missense probably damaging 0.99
IGL01454:Zscan20 APN 4 128589541 missense probably benign 0.01
IGL01934:Zscan20 APN 4 128592484 missense possibly damaging 0.94
IGL02288:Zscan20 APN 4 128586643 missense probably damaging 1.00
IGL02336:Zscan20 APN 4 128585794 missense probably damaging 1.00
IGL02385:Zscan20 APN 4 128604599 missense possibly damaging 0.66
IGL02437:Zscan20 APN 4 128588417 missense probably damaging 1.00
IGL02450:Zscan20 APN 4 128586657 missense probably damaging 0.99
R0034:Zscan20 UTSW 4 128585662 missense probably damaging 0.96
R0034:Zscan20 UTSW 4 128585662 missense probably damaging 0.96
R0070:Zscan20 UTSW 4 128585882 missense possibly damaging 0.73
R0142:Zscan20 UTSW 4 128585837 missense probably benign 0.38
R0496:Zscan20 UTSW 4 128591889 missense probably benign 0.42
R0567:Zscan20 UTSW 4 128589450 critical splice donor site probably null
R1333:Zscan20 UTSW 4 128588096 missense possibly damaging 0.61
R1716:Zscan20 UTSW 4 128586541 missense probably damaging 0.96
R2302:Zscan20 UTSW 4 128588264 missense probably damaging 1.00
R3870:Zscan20 UTSW 4 128586425 missense probably damaging 1.00
R4611:Zscan20 UTSW 4 128588106 missense probably benign 0.00
R4884:Zscan20 UTSW 4 128588165 missense possibly damaging 0.56
R4972:Zscan20 UTSW 4 128592359 missense probably benign 0.39
R5033:Zscan20 UTSW 4 128586128 missense probably benign 0.01
R5160:Zscan20 UTSW 4 128592482 missense possibly damaging 0.69
R5182:Zscan20 UTSW 4 128586711 missense possibly damaging 0.71
R5214:Zscan20 UTSW 4 128588316 missense probably benign 0.00
R5345:Zscan20 UTSW 4 128588121 missense probably benign 0.04
R5863:Zscan20 UTSW 4 128586348 nonsense probably null
R6217:Zscan20 UTSW 4 128604534 missense probably damaging 1.00
R6751:Zscan20 UTSW 4 128585875 missense probably damaging 1.00
R6852:Zscan20 UTSW 4 128589722 missense probably damaging 1.00
R7172:Zscan20 UTSW 4 128585676 nonsense probably null
R7338:Zscan20 UTSW 4 128588150 missense probably benign
R7805:Zscan20 UTSW 4 128585806 missense probably damaging 1.00
R8063:Zscan20 UTSW 4 128586235 missense probably benign 0.01
R8244:Zscan20 UTSW 4 128585966 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- CAGCAAGCTTAAACATCGGAAG -3'
(R):5'- AGCGTTCCAAGCTCATCAC -3'

Sequencing Primer
(F):5'- ACACATTATTGCTTCTGTCAGGAGG -3'
(R):5'- GCTCATCACCCACCAGAGG -3'
Posted On2018-06-22