Incidental Mutation 'R6597:Fbxl8'
ID524941
Institutional Source Beutler Lab
Gene Symbol Fbxl8
Ensembl Gene ENSMUSG00000033313
Gene NameF-box and leucine-rich repeat protein 8
SynonymsFBL8
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6597 (G1)
Quality Score90.0077
Status Validated
Chromosome8
Chromosomal Location105264648-105269326 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 105268891 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 345 (D345A)
Ref Sequence ENSEMBL: ENSMUSP00000038638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034359] [ENSMUST00000036127] [ENSMUST00000036221] [ENSMUST00000126923] [ENSMUST00000144762] [ENSMUST00000163734] [ENSMUST00000172525] [ENSMUST00000173102] [ENSMUST00000173640] [ENSMUST00000173859] [ENSMUST00000174837]
Predicted Effect probably benign
Transcript: ENSMUST00000034359
SMART Domains Protein: ENSMUSP00000034359
Gene: ENSMUSG00000031887

DomainStartEndE-ValueType
Pfam:TRADD_N 51 161 2.9e-49 PFAM
DEATH 203 303 1.14e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036127
SMART Domains Protein: ENSMUSP00000048904
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 383 8e-88 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000036221
AA Change: D345A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000038638
Gene: ENSMUSG00000033313
AA Change: D345A

DomainStartEndE-ValueType
FBOX 8 48 2.72e-6 SMART
low complexity region 102 113 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126923
SMART Domains Protein: ENSMUSP00000115366
Gene: ENSMUSG00000033313

DomainStartEndE-ValueType
FBOX 8 48 2.72e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144762
SMART Domains Protein: ENSMUSP00000119174
Gene: ENSMUSG00000031887

DomainStartEndE-ValueType
PDB:1F2H|A 1 50 7e-23 PDB
SCOP:d1f3va_ 8 50 4e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147670
SMART Domains Protein: ENSMUSP00000115535
Gene: ENSMUSG00000031887

DomainStartEndE-ValueType
PDB:1F2H|A 1 56 6e-23 PDB
SCOP:d1f3va_ 8 50 1e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163734
SMART Domains Protein: ENSMUSP00000126278
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 9 60 1.43e-1 SMART
Blast:HSF 99 323 2e-88 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172525
SMART Domains Protein: ENSMUSP00000134206
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 243 3e-36 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173102
Predicted Effect probably benign
Transcript: ENSMUST00000173640
SMART Domains Protein: ENSMUSP00000133532
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 284 1e-50 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173859
SMART Domains Protein: ENSMUSP00000134213
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 353 1e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174837
SMART Domains Protein: ENSMUSP00000134477
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 290 3e-50 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class. It shares 78% sequence identity with the mouse protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik G T 1: 136,226,189 A87E probably damaging Het
A2m A G 6: 121,648,121 Y486C probably damaging Het
Asb17 A T 3: 153,844,684 T118S probably damaging Het
Atl2 T A 17: 79,852,766 D293V possibly damaging Het
Bbs1 T A 19: 4,899,306 M242L probably benign Het
Btg1 T A 10: 96,618,320 S65T probably damaging Het
Cfap54 T C 10: 92,999,040 D1101G possibly damaging Het
Cmpk2 G T 12: 26,474,145 V314L possibly damaging Het
Gys2 T A 6: 142,456,309 H268L probably benign Het
Hecw1 T A 13: 14,316,818 R117* probably null Het
Hoxd10 G A 2: 74,692,640 A221T probably benign Het
Hspa13 A T 16: 75,765,197 L38Q probably damaging Het
Ipo11 A G 13: 106,865,863 probably null Het
Itgb8 A G 12: 119,173,398 V390A possibly damaging Het
Kalrn T A 16: 34,182,747 I1370F probably damaging Het
Macf1 T C 4: 123,382,692 N6086S probably damaging Het
Ms4a13 T C 19: 11,192,939 T14A probably benign Het
Olfr1164 A G 2: 88,093,069 F289S probably damaging Het
Olfr1500 T A 19: 13,828,457 probably benign Het
Olfr204 C T 16: 59,315,350 R19H probably benign Het
Olfr545 A T 7: 102,494,421 I118N probably damaging Het
Olfr742 T A 14: 50,515,551 C116S probably benign Het
Olfr911-ps1 A T 9: 38,524,004 I91F probably benign Het
Patl2 T A 2: 122,186,164 probably benign Het
Pcdhga7 T C 18: 37,717,006 S689P probably benign Het
Pitpnc1 G T 11: 107,226,232 Y227* probably null Het
Pla2g2e T C 4: 138,880,673 V22A unknown Het
Ppil1 C A 17: 29,261,878 V24F probably benign Het
Prl3b1 G A 13: 27,247,974 probably null Het
Rabgef1 G A 5: 130,191,044 probably null Het
Rhot2 A T 17: 25,840,912 W341R probably damaging Het
Rps6kc1 A T 1: 190,750,184 W286R probably benign Het
Rrs1 A G 1: 9,546,376 T285A probably damaging Het
Shc3 T A 13: 51,442,973 D338V possibly damaging Het
Siglech A T 7: 55,768,463 M60L probably benign Het
Slc12a6 G T 2: 112,352,935 V756F probably damaging Het
Slc43a2 G A 11: 75,571,855 G507D probably damaging Het
Slf1 A G 13: 77,049,129 S789P probably benign Het
Spata31d1d C A 13: 59,726,057 M1221I probably benign Het
Srgap1 T C 10: 121,792,371 N899D probably benign Het
Stag1 G A 9: 100,887,420 M529I probably benign Het
Tekt3 A G 11: 63,081,259 D247G probably benign Het
Tmppe A T 9: 114,405,244 M204L probably benign Het
Tpsg1 G A 17: 25,369,297 probably benign Het
Ttn A G 2: 76,797,971 V6288A probably benign Het
Ttn A T 2: 76,893,100 probably benign Het
Twsg1 C A 17: 65,937,804 V73F probably damaging Het
Vmn2r102 A G 17: 19,694,188 T672A probably damaging Het
Vps36 A G 8: 22,202,304 I66V probably benign Het
Xrcc4 A T 13: 90,000,929 D157E probably benign Het
Zbbx T A 3: 75,136,454 Q162L probably damaging Het
Zfp560 T A 9: 20,348,001 I522L probably benign Het
Zscan20 T C 4: 128,585,746 N984S probably damaging Het
Other mutations in Fbxl8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02794:Fbxl8 APN 8 105268120 missense probably benign 0.01
IGL03405:Fbxl8 APN 8 105268120 missense probably benign 0.07
R0993:Fbxl8 UTSW 8 105267085 missense probably damaging 1.00
R1861:Fbxl8 UTSW 8 105268929 missense probably damaging 1.00
R2042:Fbxl8 UTSW 8 105268224 missense probably damaging 0.96
R3848:Fbxl8 UTSW 8 105267149 missense probably benign 0.04
R3850:Fbxl8 UTSW 8 105267149 missense probably benign 0.04
R4957:Fbxl8 UTSW 8 105268195 missense probably damaging 0.99
R5153:Fbxl8 UTSW 8 105267107 missense probably damaging 1.00
R5161:Fbxl8 UTSW 8 105268906 missense possibly damaging 0.71
R6603:Fbxl8 UTSW 8 105268210 missense probably damaging 0.98
R6962:Fbxl8 UTSW 8 105268706 missense possibly damaging 0.71
R7044:Fbxl8 UTSW 8 105267015 start codon destroyed probably null 0.99
R7566:Fbxl8 UTSW 8 105268306 missense possibly damaging 0.82
R8027:Fbxl8 UTSW 8 105268126 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTCCCCTCTGCCTGATGAAG -3'
(R):5'- AGTCAACGGAGCCCCTAAAGAG -3'

Sequencing Primer
(F):5'- TCTCCGGTGACACTGTAGGAC -3'
(R):5'- CCCTAAAGAGACTAGCAACTGGG -3'
Posted On2018-06-22