Incidental Mutation 'R6629:Cubn'
ID 524955
Institutional Source Beutler Lab
Gene Symbol Cubn
Ensembl Gene ENSMUSG00000026726
Gene Name cubilin
Synonyms D2Wsu88e, intrinsic factor-cobalamin receptor
MMRRC Submission 044751-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6629 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 13281149-13496624 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 13435683 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 1091 (T1091M)
Ref Sequence ENSEMBL: ENSMUSP00000089009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091436]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000091436
AA Change: T1091M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089009
Gene: ENSMUSG00000026726
AA Change: T1091M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF 132 165 2.14e-5 SMART
EGF_CA 167 208 1.95e-8 SMART
EGF 213 258 2.85e-1 SMART
EGF_CA 260 301 2.66e-10 SMART
EGF_CA 302 345 7.07e-6 SMART
EGF 349 393 1.01e-1 SMART
EGF 398 430 3.73e-5 SMART
EGF_CA 432 468 8.63e-10 SMART
CUB 474 586 4.4e-21 SMART
CUB 590 702 3.82e-39 SMART
CUB 708 816 3.66e-18 SMART
CUB 817 928 3.09e-25 SMART
CUB 932 1042 1.29e-36 SMART
CUB 1048 1161 3.46e-37 SMART
CUB 1165 1277 7.24e-40 SMART
CUB 1278 1389 8.33e-31 SMART
CUB 1391 1506 3.08e-43 SMART
CUB 1510 1619 1.9e-34 SMART
CUB 1620 1734 7.24e-40 SMART
CUB 1738 1850 6.02e-37 SMART
CUB 1852 1963 1.57e-26 SMART
CUB 1978 2091 3.46e-28 SMART
CUB 2092 2213 2.88e-34 SMART
CUB 2217 2334 4.13e-35 SMART
CUB 2336 2448 3.1e-39 SMART
CUB 2452 2565 5.37e-34 SMART
CUB 2570 2687 3e-23 SMART
CUB 2689 2801 3.1e-39 SMART
CUB 2805 2919 2.36e-21 SMART
CUB 2920 3035 6.18e-25 SMART
CUB 3037 3150 5.16e-36 SMART
CUB 3157 3274 1.68e-35 SMART
CUB 3278 3393 7.17e-12 SMART
CUB 3395 3507 2.49e-29 SMART
CUB 3511 3623 2.4e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195447
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cubilin (CUBN) acts as a receptor for intrinsic factor-vitamin B12 complexes. The role of receptor is supported by the presence of 27 CUB domains. Cubulin is located within the epithelium of intestine and kidney. Mutations in CUBN may play a role in autosomal recessive megaloblastic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, yolk sac and allantoic vasculature defects, embryonic and visceral endoderm defects, and lack somites. Heterozygotes display incomplete penetrance of premature death. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, other(1) Gene trapped(3)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn3 A T 12: 101,903,665 (GRCm39) M180K probably benign Het
Bnip2 G T 9: 69,909,393 (GRCm39) R236L probably null Het
Boc T C 16: 44,312,724 (GRCm39) D582G probably benign Het
Cacul1 T C 19: 60,568,805 (GRCm39) S118G probably benign Het
Ccdc192 T C 18: 57,863,852 (GRCm39) S219P possibly damaging Het
Cpa2 A T 6: 30,554,193 (GRCm39) D271V probably damaging Het
Dlgap2 A G 8: 14,881,465 (GRCm39) T846A probably benign Het
Eif5 G T 12: 111,510,042 (GRCm39) A329S probably damaging Het
Fam136b-ps G A 15: 31,276,962 (GRCm39) probably benign Het
Gnrhr A G 5: 86,330,168 (GRCm39) V284A probably benign Het
Grin3a A G 4: 49,844,991 (GRCm39) S31P probably damaging Het
Hectd2 T C 19: 36,592,938 (GRCm39) L701P probably damaging Het
Hook1 C T 4: 95,889,507 (GRCm39) T241I probably benign Het
Kif5a A G 10: 127,084,123 (GRCm39) V52A probably damaging Het
Lasp1 T A 11: 97,697,722 (GRCm39) Y11* probably null Het
Meltf A G 16: 31,703,894 (GRCm39) Y207C probably damaging Het
Mllt3 ACTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTACTACTACTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCT ACTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTACTACTACTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCT 4: 87,759,504 (GRCm39) probably benign Het
Nek1 A G 8: 61,507,367 (GRCm39) probably null Het
Notch2 C A 3: 98,028,197 (GRCm39) N969K possibly damaging Het
Or4c116 T A 2: 88,942,506 (GRCm39) M117L probably benign Het
Pcnx2 C T 8: 126,617,851 (GRCm39) G135R probably benign Het
Pla2g4f A T 2: 120,138,723 (GRCm39) L242Q probably damaging Het
Plcxd2 T G 16: 45,785,470 (GRCm39) T312P probably damaging Het
Prpf4 G A 4: 62,336,097 (GRCm39) V275I possibly damaging Het
Prpf8 G A 11: 75,386,252 (GRCm39) probably null Het
Pxn T C 5: 115,692,121 (GRCm39) L401P probably damaging Het
Rab44 A T 17: 29,354,754 (GRCm39) probably benign Het
Rfx6 C A 10: 51,601,586 (GRCm39) T669K probably benign Het
Rgs16 A G 1: 153,619,420 (GRCm39) N142S probably damaging Het
Rhobtb1 A G 10: 69,106,146 (GRCm39) E237G possibly damaging Het
Rsbn1 A C 3: 103,835,757 (GRCm39) D265A probably damaging Het
Rufy4 A G 1: 74,171,526 (GRCm39) probably null Het
Slc4a1 C A 11: 102,252,048 (GRCm39) E19* probably null Het
Tctn1 A G 5: 122,380,731 (GRCm39) S526P probably damaging Het
Tspear A T 10: 77,706,343 (GRCm39) H371L probably benign Het
Vmn1r34 A T 6: 66,614,499 (GRCm39) F80I probably benign Het
Wdr75 G A 1: 45,851,216 (GRCm39) S264N probably damaging Het
Zfp652 A T 11: 95,654,616 (GRCm39) N340Y probably damaging Het
Zp3 A G 5: 136,016,190 (GRCm39) T306A probably benign Het
Other mutations in Cubn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Cubn APN 2 13,496,631 (GRCm39) unclassified probably benign
IGL00228:Cubn APN 2 13,461,508 (GRCm39) missense probably damaging 1.00
IGL00231:Cubn APN 2 13,386,660 (GRCm39) missense possibly damaging 0.89
IGL00327:Cubn APN 2 13,431,867 (GRCm39) missense possibly damaging 0.73
IGL00470:Cubn APN 2 13,283,229 (GRCm39) missense probably benign 0.00
IGL00519:Cubn APN 2 13,287,730 (GRCm39) missense probably benign 0.00
IGL00562:Cubn APN 2 13,299,041 (GRCm39) missense probably benign 0.01
IGL00678:Cubn APN 2 13,472,521 (GRCm39) missense possibly damaging 0.47
IGL00834:Cubn APN 2 13,386,738 (GRCm39) missense probably damaging 1.00
IGL00946:Cubn APN 2 13,461,434 (GRCm39) missense probably damaging 0.98
IGL00971:Cubn APN 2 13,283,219 (GRCm39) missense possibly damaging 0.77
IGL01124:Cubn APN 2 13,482,904 (GRCm39) missense possibly damaging 0.62
IGL01287:Cubn APN 2 13,315,377 (GRCm39) missense probably damaging 1.00
IGL01410:Cubn APN 2 13,470,719 (GRCm39) missense probably benign 0.31
IGL01418:Cubn APN 2 13,288,852 (GRCm39) missense probably benign 0.01
IGL01450:Cubn APN 2 13,355,673 (GRCm39) splice site probably benign
IGL01534:Cubn APN 2 13,470,744 (GRCm39) nonsense probably null
IGL01584:Cubn APN 2 13,313,472 (GRCm39) splice site probably benign
IGL01595:Cubn APN 2 13,330,027 (GRCm39) missense probably benign 0.05
IGL01625:Cubn APN 2 13,311,085 (GRCm39) missense possibly damaging 0.76
IGL01732:Cubn APN 2 13,494,747 (GRCm39) nonsense probably null
IGL01972:Cubn APN 2 13,450,883 (GRCm39) missense possibly damaging 0.90
IGL02027:Cubn APN 2 13,292,405 (GRCm39) missense probably damaging 1.00
IGL02033:Cubn APN 2 13,344,657 (GRCm39) missense probably damaging 0.98
IGL02124:Cubn APN 2 13,386,648 (GRCm39) missense probably damaging 0.99
IGL02335:Cubn APN 2 13,432,645 (GRCm39) splice site probably null
IGL02491:Cubn APN 2 13,326,039 (GRCm39) missense probably damaging 1.00
IGL02686:Cubn APN 2 13,330,037 (GRCm39) missense possibly damaging 0.92
IGL02707:Cubn APN 2 13,450,843 (GRCm39) missense probably damaging 0.99
IGL02746:Cubn APN 2 13,449,851 (GRCm39) missense probably damaging 1.00
IGL02873:Cubn APN 2 13,299,181 (GRCm39) missense probably benign 0.07
IGL02897:Cubn APN 2 13,323,123 (GRCm39) missense possibly damaging 0.55
IGL03078:Cubn APN 2 13,291,905 (GRCm39) missense possibly damaging 0.87
IGL03245:Cubn APN 2 13,360,500 (GRCm39) missense probably benign 0.09
IGL03289:Cubn APN 2 13,431,778 (GRCm39) missense probably benign 0.00
IGL03335:Cubn APN 2 13,365,140 (GRCm39) missense probably damaging 1.00
IGL03355:Cubn APN 2 13,482,868 (GRCm39) splice site probably null
mellow UTSW 2 13,482,889 (GRCm39) missense probably damaging 1.00
PIT4354001:Cubn UTSW 2 13,473,663 (GRCm39) nonsense probably null
PIT4495001:Cubn UTSW 2 13,496,561 (GRCm39) missense probably benign 0.00
R0145:Cubn UTSW 2 13,311,243 (GRCm39) missense probably damaging 1.00
R0220:Cubn UTSW 2 13,361,520 (GRCm39) missense probably damaging 1.00
R0254:Cubn UTSW 2 13,480,846 (GRCm39) critical splice donor site probably null
R0254:Cubn UTSW 2 13,445,325 (GRCm39) missense possibly damaging 0.84
R0254:Cubn UTSW 2 13,429,505 (GRCm39) missense probably benign 0.01
R0360:Cubn UTSW 2 13,315,318 (GRCm39) splice site probably benign
R0364:Cubn UTSW 2 13,315,318 (GRCm39) splice site probably benign
R0383:Cubn UTSW 2 13,435,770 (GRCm39) missense probably damaging 1.00
R0419:Cubn UTSW 2 13,474,575 (GRCm39) missense possibly damaging 0.87
R0419:Cubn UTSW 2 13,474,574 (GRCm39) missense possibly damaging 0.77
R0498:Cubn UTSW 2 13,449,078 (GRCm39) missense probably damaging 0.99
R0560:Cubn UTSW 2 13,433,491 (GRCm39) missense probably damaging 1.00
R0615:Cubn UTSW 2 13,365,063 (GRCm39) splice site probably null
R0735:Cubn UTSW 2 13,496,500 (GRCm39) splice site probably benign
R0780:Cubn UTSW 2 13,461,424 (GRCm39) missense probably damaging 1.00
R0899:Cubn UTSW 2 13,367,139 (GRCm39) missense possibly damaging 0.54
R1118:Cubn UTSW 2 13,341,053 (GRCm39) missense possibly damaging 0.78
R1182:Cubn UTSW 2 13,449,811 (GRCm39) missense probably damaging 0.98
R1439:Cubn UTSW 2 13,292,379 (GRCm39) missense probably damaging 0.96
R1450:Cubn UTSW 2 13,365,130 (GRCm39) missense probably damaging 1.00
R1464:Cubn UTSW 2 13,330,099 (GRCm39) missense possibly damaging 0.87
R1464:Cubn UTSW 2 13,330,099 (GRCm39) missense possibly damaging 0.87
R1476:Cubn UTSW 2 13,480,931 (GRCm39) missense probably benign 0.04
R1508:Cubn UTSW 2 13,431,916 (GRCm39) missense probably benign 0.25
R1532:Cubn UTSW 2 13,292,472 (GRCm39) missense probably damaging 1.00
R1562:Cubn UTSW 2 13,432,778 (GRCm39) missense probably damaging 1.00
R1598:Cubn UTSW 2 13,474,600 (GRCm39) missense probably benign 0.00
R1761:Cubn UTSW 2 13,494,128 (GRCm39) critical splice donor site probably null
R1862:Cubn UTSW 2 13,313,372 (GRCm39) missense probably damaging 1.00
R1874:Cubn UTSW 2 13,327,813 (GRCm39) missense probably damaging 1.00
R1923:Cubn UTSW 2 13,315,337 (GRCm39) missense probably damaging 1.00
R1944:Cubn UTSW 2 13,283,349 (GRCm39) missense probably benign 0.01
R1960:Cubn UTSW 2 13,344,828 (GRCm39) splice site probably null
R2021:Cubn UTSW 2 13,313,360 (GRCm39) missense probably benign 0.09
R2137:Cubn UTSW 2 13,340,978 (GRCm39) missense probably benign 0.01
R2138:Cubn UTSW 2 13,449,189 (GRCm39) missense probably damaging 0.99
R2139:Cubn UTSW 2 13,340,978 (GRCm39) missense probably benign 0.01
R2179:Cubn UTSW 2 13,323,053 (GRCm39) missense possibly damaging 0.85
R2328:Cubn UTSW 2 13,408,891 (GRCm39) nonsense probably null
R2369:Cubn UTSW 2 13,496,028 (GRCm39) missense probably damaging 1.00
R2428:Cubn UTSW 2 13,480,961 (GRCm39) missense probably damaging 1.00
R2435:Cubn UTSW 2 13,323,083 (GRCm39) missense probably damaging 1.00
R2567:Cubn UTSW 2 13,283,167 (GRCm39) splice site probably null
R2850:Cubn UTSW 2 13,327,764 (GRCm39) missense probably damaging 1.00
R2853:Cubn UTSW 2 13,435,645 (GRCm39) missense probably benign 0.00
R2893:Cubn UTSW 2 13,362,950 (GRCm39) missense possibly damaging 0.61
R3107:Cubn UTSW 2 13,367,158 (GRCm39) missense possibly damaging 0.73
R3109:Cubn UTSW 2 13,367,158 (GRCm39) missense possibly damaging 0.73
R3119:Cubn UTSW 2 13,362,973 (GRCm39) missense possibly damaging 0.90
R3405:Cubn UTSW 2 13,338,319 (GRCm39) missense probably benign 0.00
R3703:Cubn UTSW 2 13,355,754 (GRCm39) missense probably damaging 1.00
R3704:Cubn UTSW 2 13,355,754 (GRCm39) missense probably damaging 1.00
R3705:Cubn UTSW 2 13,355,754 (GRCm39) missense probably damaging 1.00
R3764:Cubn UTSW 2 13,336,396 (GRCm39) missense possibly damaging 0.79
R3792:Cubn UTSW 2 13,432,725 (GRCm39) missense probably damaging 1.00
R3802:Cubn UTSW 2 13,365,164 (GRCm39) missense probably benign 0.01
R3813:Cubn UTSW 2 13,299,136 (GRCm39) missense probably damaging 1.00
R3845:Cubn UTSW 2 13,287,819 (GRCm39) missense probably damaging 1.00
R3846:Cubn UTSW 2 13,287,819 (GRCm39) missense probably damaging 1.00
R3900:Cubn UTSW 2 13,291,791 (GRCm39) critical splice donor site probably null
R3921:Cubn UTSW 2 13,331,488 (GRCm39) missense probably damaging 1.00
R4075:Cubn UTSW 2 13,318,810 (GRCm39) missense possibly damaging 0.58
R4082:Cubn UTSW 2 13,433,374 (GRCm39) intron probably benign
R4405:Cubn UTSW 2 13,470,841 (GRCm39) missense probably damaging 1.00
R4615:Cubn UTSW 2 13,433,560 (GRCm39) missense probably damaging 1.00
R4629:Cubn UTSW 2 13,318,790 (GRCm39) splice site probably null
R4770:Cubn UTSW 2 13,319,578 (GRCm39) missense possibly damaging 0.92
R4799:Cubn UTSW 2 13,355,869 (GRCm39) missense probably damaging 1.00
R4799:Cubn UTSW 2 13,291,835 (GRCm39) missense possibly damaging 0.94
R4812:Cubn UTSW 2 13,463,887 (GRCm39) missense probably damaging 1.00
R4825:Cubn UTSW 2 13,330,036 (GRCm39) missense probably damaging 1.00
R4934:Cubn UTSW 2 13,494,721 (GRCm39) missense probably benign 0.06
R4967:Cubn UTSW 2 13,352,856 (GRCm39) missense probably benign 0.01
R5187:Cubn UTSW 2 13,292,379 (GRCm39) missense probably damaging 0.96
R5232:Cubn UTSW 2 13,483,013 (GRCm39) nonsense probably null
R5305:Cubn UTSW 2 13,393,750 (GRCm39) missense probably damaging 1.00
R5506:Cubn UTSW 2 13,496,506 (GRCm39) splice site probably null
R5530:Cubn UTSW 2 13,313,334 (GRCm39) missense probably damaging 1.00
R5531:Cubn UTSW 2 13,355,743 (GRCm39) missense probably benign 0.00
R5737:Cubn UTSW 2 13,393,702 (GRCm39) missense probably damaging 1.00
R5886:Cubn UTSW 2 13,324,834 (GRCm39) splice site probably benign
R5923:Cubn UTSW 2 13,490,889 (GRCm39) missense possibly damaging 0.73
R6032:Cubn UTSW 2 13,329,995 (GRCm39) missense probably benign 0.12
R6032:Cubn UTSW 2 13,329,995 (GRCm39) missense probably benign 0.12
R6084:Cubn UTSW 2 13,435,708 (GRCm39) missense probably damaging 1.00
R6087:Cubn UTSW 2 13,432,658 (GRCm39) missense probably damaging 1.00
R6133:Cubn UTSW 2 13,313,429 (GRCm39) missense probably benign 0.29
R6181:Cubn UTSW 2 13,354,687 (GRCm39) missense probably benign 0.31
R6301:Cubn UTSW 2 13,482,889 (GRCm39) missense probably damaging 1.00
R6320:Cubn UTSW 2 13,285,006 (GRCm39) missense probably damaging 1.00
R6368:Cubn UTSW 2 13,480,934 (GRCm39) missense probably damaging 0.98
R6368:Cubn UTSW 2 13,435,806 (GRCm39) missense probably damaging 0.96
R6383:Cubn UTSW 2 13,432,646 (GRCm39) critical splice donor site probably null
R6393:Cubn UTSW 2 13,360,491 (GRCm39) missense probably benign 0.08
R6408:Cubn UTSW 2 13,299,014 (GRCm39) missense probably damaging 1.00
R6470:Cubn UTSW 2 13,327,804 (GRCm39) missense possibly damaging 0.87
R6532:Cubn UTSW 2 13,463,813 (GRCm39) missense probably benign 0.01
R6599:Cubn UTSW 2 13,315,484 (GRCm39) missense possibly damaging 0.95
R6641:Cubn UTSW 2 13,480,875 (GRCm39) missense probably damaging 1.00
R6800:Cubn UTSW 2 13,326,066 (GRCm39) missense probably damaging 1.00
R6823:Cubn UTSW 2 13,449,840 (GRCm39) missense probably benign 0.21
R6847:Cubn UTSW 2 13,449,064 (GRCm39) critical splice donor site probably null
R6885:Cubn UTSW 2 13,323,089 (GRCm39) missense probably damaging 1.00
R6962:Cubn UTSW 2 13,352,840 (GRCm39) missense probably benign 0.03
R6973:Cubn UTSW 2 13,386,648 (GRCm39) missense possibly damaging 0.61
R6975:Cubn UTSW 2 13,491,600 (GRCm39) missense probably damaging 0.99
R7076:Cubn UTSW 2 13,311,092 (GRCm39) missense probably benign 0.10
R7076:Cubn UTSW 2 13,311,091 (GRCm39) missense probably benign 0.00
R7086:Cubn UTSW 2 13,324,669 (GRCm39) missense probably damaging 0.98
R7162:Cubn UTSW 2 13,347,309 (GRCm39) missense probably damaging 0.96
R7203:Cubn UTSW 2 13,355,814 (GRCm39) missense probably benign 0.01
R7292:Cubn UTSW 2 13,429,550 (GRCm39) missense probably damaging 0.99
R7307:Cubn UTSW 2 13,345,143 (GRCm39) missense probably damaging 0.99
R7329:Cubn UTSW 2 13,473,582 (GRCm39) missense probably damaging 0.99
R7395:Cubn UTSW 2 13,291,875 (GRCm39) missense probably damaging 1.00
R7417:Cubn UTSW 2 13,431,778 (GRCm39) missense probably benign 0.00
R7429:Cubn UTSW 2 13,327,804 (GRCm39) missense possibly damaging 0.87
R7430:Cubn UTSW 2 13,327,804 (GRCm39) missense possibly damaging 0.87
R7443:Cubn UTSW 2 13,460,320 (GRCm39) missense probably damaging 1.00
R7699:Cubn UTSW 2 13,494,728 (GRCm39) missense possibly damaging 0.74
R7699:Cubn UTSW 2 13,352,989 (GRCm39) missense probably benign
R7700:Cubn UTSW 2 13,494,728 (GRCm39) missense possibly damaging 0.74
R7700:Cubn UTSW 2 13,352,989 (GRCm39) missense probably benign
R7751:Cubn UTSW 2 13,365,176 (GRCm39) missense probably damaging 1.00
R7755:Cubn UTSW 2 13,284,889 (GRCm39) missense probably benign 0.11
R7759:Cubn UTSW 2 13,352,961 (GRCm39) missense probably damaging 1.00
R7903:Cubn UTSW 2 13,473,680 (GRCm39) missense probably damaging 0.97
R7921:Cubn UTSW 2 13,429,538 (GRCm39) missense probably benign 0.22
R7988:Cubn UTSW 2 13,337,166 (GRCm39) missense probably benign 0.43
R8010:Cubn UTSW 2 13,340,897 (GRCm39) critical splice donor site probably null
R8020:Cubn UTSW 2 13,483,989 (GRCm39) missense probably benign 0.01
R8120:Cubn UTSW 2 13,336,471 (GRCm39) missense probably damaging 1.00
R8133:Cubn UTSW 2 13,393,659 (GRCm39) missense probably damaging 1.00
R8185:Cubn UTSW 2 13,299,129 (GRCm39) missense probably benign 0.11
R8224:Cubn UTSW 2 13,354,688 (GRCm39) missense probably benign 0.16
R8289:Cubn UTSW 2 13,491,613 (GRCm39) missense probably benign 0.10
R8326:Cubn UTSW 2 13,311,274 (GRCm39) missense probably benign 0.01
R8331:Cubn UTSW 2 13,345,053 (GRCm39) missense probably damaging 1.00
R8338:Cubn UTSW 2 13,435,658 (GRCm39) missense probably benign 0.08
R8341:Cubn UTSW 2 13,433,535 (GRCm39) missense probably damaging 1.00
R8358:Cubn UTSW 2 13,329,971 (GRCm39) missense probably benign 0.17
R8427:Cubn UTSW 2 13,433,567 (GRCm39) missense probably benign 0.00
R8432:Cubn UTSW 2 13,386,610 (GRCm39) missense probably benign 0.00
R8441:Cubn UTSW 2 13,432,658 (GRCm39) missense probably damaging 1.00
R8442:Cubn UTSW 2 13,318,855 (GRCm39) missense probably damaging 1.00
R8520:Cubn UTSW 2 13,313,331 (GRCm39) critical splice donor site probably null
R8699:Cubn UTSW 2 13,388,770 (GRCm39) missense probably damaging 1.00
R8753:Cubn UTSW 2 13,313,377 (GRCm39) nonsense probably null
R8874:Cubn UTSW 2 13,365,157 (GRCm39) missense possibly damaging 0.63
R9056:Cubn UTSW 2 13,461,466 (GRCm39) missense probably damaging 1.00
R9079:Cubn UTSW 2 13,291,914 (GRCm39) missense probably benign 0.02
R9143:Cubn UTSW 2 13,337,276 (GRCm39) splice site probably benign
R9261:Cubn UTSW 2 13,283,262 (GRCm39) missense probably damaging 1.00
R9338:Cubn UTSW 2 13,386,703 (GRCm39) missense probably damaging 1.00
R9342:Cubn UTSW 2 13,463,767 (GRCm39) missense probably damaging 0.99
R9603:Cubn UTSW 2 13,292,510 (GRCm39) missense probably damaging 1.00
R9614:Cubn UTSW 2 13,482,945 (GRCm39) missense probably benign 0.00
R9615:Cubn UTSW 2 13,325,991 (GRCm39) missense possibly damaging 0.88
R9616:Cubn UTSW 2 13,319,529 (GRCm39) missense probably benign 0.04
R9774:Cubn UTSW 2 13,433,530 (GRCm39) missense probably benign
X0018:Cubn UTSW 2 13,463,797 (GRCm39) missense probably damaging 1.00
X0022:Cubn UTSW 2 13,480,887 (GRCm39) missense probably damaging 1.00
X0026:Cubn UTSW 2 13,347,392 (GRCm39) missense probably damaging 1.00
X0063:Cubn UTSW 2 13,327,773 (GRCm39) missense probably damaging 1.00
YA93:Cubn UTSW 2 13,388,803 (GRCm39) missense probably benign 0.21
Z1088:Cubn UTSW 2 13,299,040 (GRCm39) missense probably benign 0.43
Z1176:Cubn UTSW 2 13,386,636 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCACTTCCTTTGCCTAAGTAAAC -3'
(R):5'- ACACATGCAAGTTATAATGCTTCCC -3'

Sequencing Primer
(F):5'- TAGAGGATCAAACATCTCTTCCTGC -3'
(R):5'- GCAAGTTATAATGCTTCCCATTTTTC -3'
Posted On 2018-06-22