Incidental Mutation 'R6597:Tekt3'
ID524956
Institutional Source Beutler Lab
Gene Symbol Tekt3
Ensembl Gene ENSMUSG00000042189
Gene Nametektin 3
Synonyms4933407G07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6597 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location63061654-63094964 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63081259 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 247 (D247G)
Ref Sequence ENSEMBL: ENSMUSP00000042063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035732]
Predicted Effect probably benign
Transcript: ENSMUST00000035732
AA Change: D247G

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000042063
Gene: ENSMUSG00000042189
AA Change: D247G

DomainStartEndE-ValueType
Pfam:Tektin 99 481 5.6e-149 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the tektin family of proteins. Tektins comprise a family of filament-forming proteins that are coassembled with tubulins to form ciliary and flagellar microtubules. The exact function of this gene is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit defective sperm motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik G T 1: 136,226,189 A87E probably damaging Het
A2m A G 6: 121,648,121 Y486C probably damaging Het
Asb17 A T 3: 153,844,684 T118S probably damaging Het
Atl2 T A 17: 79,852,766 D293V possibly damaging Het
Bbs1 T A 19: 4,899,306 M242L probably benign Het
Btg1 T A 10: 96,618,320 S65T probably damaging Het
Cfap54 T C 10: 92,999,040 D1101G possibly damaging Het
Cmpk2 G T 12: 26,474,145 V314L possibly damaging Het
Fbxl8 A C 8: 105,268,891 D345A probably benign Het
Gys2 T A 6: 142,456,309 H268L probably benign Het
Hecw1 T A 13: 14,316,818 R117* probably null Het
Hoxd10 G A 2: 74,692,640 A221T probably benign Het
Hspa13 A T 16: 75,765,197 L38Q probably damaging Het
Ipo11 A G 13: 106,865,863 probably null Het
Itgb8 A G 12: 119,173,398 V390A possibly damaging Het
Kalrn T A 16: 34,182,747 I1370F probably damaging Het
Macf1 T C 4: 123,382,692 N6086S probably damaging Het
Ms4a13 T C 19: 11,192,939 T14A probably benign Het
Olfr1164 A G 2: 88,093,069 F289S probably damaging Het
Olfr1500 T A 19: 13,828,457 probably benign Het
Olfr204 C T 16: 59,315,350 R19H probably benign Het
Olfr545 A T 7: 102,494,421 I118N probably damaging Het
Olfr742 T A 14: 50,515,551 C116S probably benign Het
Olfr911-ps1 A T 9: 38,524,004 I91F probably benign Het
Patl2 T A 2: 122,186,164 probably benign Het
Pcdhga7 T C 18: 37,717,006 S689P probably benign Het
Pitpnc1 G T 11: 107,226,232 Y227* probably null Het
Pla2g2e T C 4: 138,880,673 V22A unknown Het
Ppil1 C A 17: 29,261,878 V24F probably benign Het
Prl3b1 G A 13: 27,247,974 probably null Het
Rabgef1 G A 5: 130,191,044 probably null Het
Rhot2 A T 17: 25,840,912 W341R probably damaging Het
Rps6kc1 A T 1: 190,750,184 W286R probably benign Het
Rrs1 A G 1: 9,546,376 T285A probably damaging Het
Shc3 T A 13: 51,442,973 D338V possibly damaging Het
Siglech A T 7: 55,768,463 M60L probably benign Het
Slc12a6 G T 2: 112,352,935 V756F probably damaging Het
Slc43a2 G A 11: 75,571,855 G507D probably damaging Het
Slf1 A G 13: 77,049,129 S789P probably benign Het
Spata31d1d C A 13: 59,726,057 M1221I probably benign Het
Srgap1 T C 10: 121,792,371 N899D probably benign Het
Stag1 G A 9: 100,887,420 M529I probably benign Het
Tmppe A T 9: 114,405,244 M204L probably benign Het
Tpsg1 G A 17: 25,369,297 probably benign Het
Ttn A G 2: 76,797,971 V6288A probably benign Het
Ttn A T 2: 76,893,100 probably benign Het
Twsg1 C A 17: 65,937,804 V73F probably damaging Het
Vmn2r102 A G 17: 19,694,188 T672A probably damaging Het
Vps36 A G 8: 22,202,304 I66V probably benign Het
Xrcc4 A T 13: 90,000,929 D157E probably benign Het
Zbbx T A 3: 75,136,454 Q162L probably damaging Het
Zfp560 T A 9: 20,348,001 I522L probably benign Het
Zscan20 T C 4: 128,585,746 N984S probably damaging Het
Other mutations in Tekt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Tekt3 APN 11 63070238 missense probably benign 0.19
IGL00851:Tekt3 APN 11 63070400 missense probably benign 0.01
IGL01469:Tekt3 APN 11 63073468 missense probably damaging 1.00
IGL02123:Tekt3 APN 11 63083940 missense probably benign 0.05
R1517:Tekt3 UTSW 11 63070490 missense probably damaging 1.00
R1616:Tekt3 UTSW 11 63087198 splice site probably null
R1750:Tekt3 UTSW 11 63070041 missense probably damaging 0.96
R2087:Tekt3 UTSW 11 63094697 missense possibly damaging 0.95
R2174:Tekt3 UTSW 11 63094688 missense possibly damaging 0.90
R2249:Tekt3 UTSW 11 63083952 missense probably benign
R4835:Tekt3 UTSW 11 63081259 missense probably benign 0.19
R5198:Tekt3 UTSW 11 63070308 missense probably damaging 1.00
R5452:Tekt3 UTSW 11 63094793 missense probably damaging 0.99
R5518:Tekt3 UTSW 11 63083942 missense probably benign 0.00
R5946:Tekt3 UTSW 11 63094747 missense probably damaging 0.98
R6150:Tekt3 UTSW 11 63094657 missense possibly damaging 0.95
R6191:Tekt3 UTSW 11 63078173 missense probably damaging 0.98
R6547:Tekt3 UTSW 11 63070478 missense possibly damaging 0.50
R7259:Tekt3 UTSW 11 63083766 missense possibly damaging 0.79
R7578:Tekt3 UTSW 11 63094660 missense probably damaging 0.99
R7878:Tekt3 UTSW 11 63070451 nonsense probably null
R7961:Tekt3 UTSW 11 63070451 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCTCAGGCCTCACATGTATG -3'
(R):5'- GGCTGTTCCATGATAGTTGTAGAATAC -3'

Sequencing Primer
(F):5'- TGTATGGCCATCTCCACAAATG -3'
(R):5'- GCCTACGTGCTGCATCATTATGAAAG -3'
Posted On2018-06-22