Incidental Mutation 'R6629:Mllt3'
ID 524970
Institutional Source Beutler Lab
Gene Symbol Mllt3
Ensembl Gene ENSMUSG00000028496
Gene Name myeloid/lymphoid or mixed-lineage leukemia; translocated to, 3
Synonyms Af9, D4Ertd321e, 2610012I03Rik, 3830408D16Rik, 2210011H10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6629 (G1)
Quality Score 117.467
Status Validated
Chromosome 4
Chromosomal Location 87769925-88033364 bp(-) (GRCm38)
Type of Mutation utr 3 prime
DNA Base Change (assembly) ACTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTACTACTACTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCT to ACTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTACTACTACTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCT at 87841267 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078090] [ENSMUST00000142454]
AlphaFold A2AM29
Predicted Effect probably benign
Transcript: ENSMUST00000078090
SMART Domains Protein: ENSMUSP00000077232
Gene: ENSMUSG00000028496

DomainStartEndE-ValueType
Pfam:YEATS 29 110 2.3e-29 PFAM
SCOP:d1l9ha_ 126 173 9e-3 SMART
internal_repeat_1 195 214 9.17e-5 PROSPERO
internal_repeat_1 206 225 9.17e-5 PROSPERO
low complexity region 226 246 N/A INTRINSIC
low complexity region 291 314 N/A INTRINSIC
SCOP:d1qbkb_ 315 467 7e-4 SMART
PDB:2LM0|A 485 569 3e-48 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134555
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141526
Predicted Effect probably benign
Transcript: ENSMUST00000142454
SMART Domains Protein: ENSMUSP00000127376
Gene: ENSMUSG00000028496

DomainStartEndE-ValueType
Pfam:YEATS 26 66 2.6e-15 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 97% (38/39)
MGI Phenotype PHENOTYPE: About 50% of homozygous null mice die perinatally while the remaining 50% become runted and die within two weeks of birth with severe defects of the axial skeleton, including anterior homeotic transformation of the cervical and thoracic regions, a deformed atlas and an extra cervical vertebra. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik T C 18: 57,730,780 S219P possibly damaging Het
Atxn3 A T 12: 101,937,406 M180K probably benign Het
Bnip2 G T 9: 70,002,111 R236L probably null Het
Boc T C 16: 44,492,361 D582G probably benign Het
Cacul1 T C 19: 60,580,367 S118G probably benign Het
Cpa2 A T 6: 30,554,194 D271V probably damaging Het
Cubn G A 2: 13,430,872 T1091M probably damaging Het
Dlgap2 A G 8: 14,831,465 T846A probably benign Het
Eif5 G T 12: 111,543,608 A329S probably damaging Het
Fam136b-ps G A 15: 31,276,816 probably benign Het
Gnrhr A G 5: 86,182,309 V284A probably benign Het
Grin3a A G 4: 49,844,991 S31P probably damaging Het
Hectd2 T C 19: 36,615,538 L701P probably damaging Het
Hook1 C T 4: 96,001,270 T241I probably benign Het
Kif5a A G 10: 127,248,254 V52A probably damaging Het
Lasp1 T A 11: 97,806,896 Y11* probably null Het
Meltf A G 16: 31,885,076 Y207C probably damaging Het
Nek1 A G 8: 61,054,333 probably null Het
Notch2 C A 3: 98,120,881 N969K possibly damaging Het
Olfr1221 T A 2: 89,112,162 M117L probably benign Het
Pcnx2 C T 8: 125,891,112 G135R probably benign Het
Pla2g4f A T 2: 120,308,242 L242Q probably damaging Het
Plcxd2 T G 16: 45,965,107 T312P probably damaging Het
Prpf4 G A 4: 62,417,860 V275I possibly damaging Het
Prpf8 G A 11: 75,495,426 probably null Het
Pxn T C 5: 115,554,062 L401P probably damaging Het
Rab44 A T 17: 29,135,780 probably benign Het
Rfx6 C A 10: 51,725,490 T669K probably benign Het
Rgs16 A G 1: 153,743,674 N142S probably damaging Het
Rhobtb1 A G 10: 69,270,316 E237G possibly damaging Het
Rsbn1 A C 3: 103,928,441 D265A probably damaging Het
Rufy4 A G 1: 74,132,367 probably null Het
Slc4a1 C A 11: 102,361,222 E19* probably null Het
Tctn1 A G 5: 122,242,668 S526P probably damaging Het
Tspear A T 10: 77,870,509 H371L probably benign Het
Vmn1r34 A T 6: 66,637,515 F80I probably benign Het
Wdr75 G A 1: 45,812,056 S264N probably damaging Het
Zfp652 A T 11: 95,763,790 N340Y probably damaging Het
Zp3 A G 5: 135,987,336 T306A probably benign Het
Other mutations in Mllt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Mllt3 APN 4 87791881 missense probably benign 0.00
IGL01078:Mllt3 APN 4 87880060 splice site probably benign
IGL01337:Mllt3 APN 4 87840820 missense probably damaging 0.99
IGL02664:Mllt3 APN 4 88031623 missense probably damaging 1.00
PIT4504001:Mllt3 UTSW 4 87774087 missense probably damaging 1.00
R0226:Mllt3 UTSW 4 87840732 missense probably benign 0.00
R0415:Mllt3 UTSW 4 87841339 utr 3 prime probably benign
R0540:Mllt3 UTSW 4 87841044 missense possibly damaging 0.73
R0618:Mllt3 UTSW 4 87841267 utr 3 prime probably benign
R0932:Mllt3 UTSW 4 87789384 missense probably damaging 0.99
R1713:Mllt3 UTSW 4 87783664 missense probably damaging 1.00
R4748:Mllt3 UTSW 4 87840781 missense possibly damaging 0.60
R4928:Mllt3 UTSW 4 87782405 splice site probably null
R5086:Mllt3 UTSW 4 87789298 missense probably damaging 0.99
R5186:Mllt3 UTSW 4 87840995 missense probably benign 0.00
R5359:Mllt3 UTSW 4 87840927 missense probably benign 0.21
R5371:Mllt3 UTSW 4 87840856 missense possibly damaging 0.64
R5713:Mllt3 UTSW 4 87841211 missense probably benign 0.01
R5787:Mllt3 UTSW 4 87840820 missense probably damaging 0.99
R6346:Mllt3 UTSW 4 87841208 missense probably damaging 1.00
R6462:Mllt3 UTSW 4 87774101 missense probably damaging 1.00
R6621:Mllt3 UTSW 4 87840797 missense possibly damaging 0.66
R7380:Mllt3 UTSW 4 87791943 missense possibly damaging 0.85
R7600:Mllt3 UTSW 4 87841219 missense probably benign 0.07
R8045:Mllt3 UTSW 4 87841113 missense probably damaging 1.00
R8871:Mllt3 UTSW 4 87841315 utr 3 prime probably benign
R9281:Mllt3 UTSW 4 87789329 missense probably benign 0.12
R9300:Mllt3 UTSW 4 87774047 nonsense probably null
R9341:Mllt3 UTSW 4 87873931 missense possibly damaging 0.46
R9343:Mllt3 UTSW 4 87873931 missense possibly damaging 0.46
R9544:Mllt3 UTSW 4 87841181 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTTCCTTGAAGGCCATCTTAG -3'
(R):5'- CTTGTTGGTGAAGGCCCATG -3'

Sequencing Primer
(F):5'- TTTCTTCTTTCAGTGGTTTGTTTTC -3'
(R):5'- GAAATAATCTTATGGTTGGGGCCACC -3'
Posted On 2018-06-22