Incidental Mutation 'R6597:Xrcc4'
ID 524975
Institutional Source Beutler Lab
Gene Symbol Xrcc4
Ensembl Gene ENSMUSG00000021615
Gene Name X-ray repair complementing defective repair in Chinese hamster cells 4
Synonyms 2310057B22Rik
MMRRC Submission 044721-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.392) question?
Stock # R6597 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 89997033-90237727 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 90149048 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 157 (D157E)
Ref Sequence ENSEMBL: ENSMUSP00000123934 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022115] [ENSMUST00000159199]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000022115
AA Change: D157E

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000022115
Gene: ENSMUSG00000021615
AA Change: D157E

DomainStartEndE-ValueType
Pfam:XRCC4 1 326 1.5e-153 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159199
AA Change: D157E

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000123934
Gene: ENSMUSG00000021615
AA Change: D157E

DomainStartEndE-ValueType
Pfam:XRCC4 1 310 2.7e-151 PFAM
Meta Mutation Damage Score 0.2709 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene functions together with DNA ligase IV and the DNA-dependent protein kinase in the repair of DNA double-strand breaks. This protein plays a role in both non-homologous end joining and the completion of V(D)J recombination. Mutations in this gene can cause short stature, microcephaly, and endocrine dysfunction (SSMED). Alternative splicing generates several transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous null mutants have massive neuronal apoptosis, growth retardation, hypoplastic thymus and die by embryonic day 17.5. Lethality is rescued by Trp53 deficiency, but double knockout mice die from pro-B-cell lymphomas with Myc-Igh translocations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,625,080 (GRCm39) Y486C probably damaging Het
Asb17 A T 3: 153,550,321 (GRCm39) T118S probably damaging Het
Atl2 T A 17: 80,160,195 (GRCm39) D293V possibly damaging Het
Bbs1 T A 19: 4,949,334 (GRCm39) M242L probably benign Het
Btg1 T A 10: 96,454,182 (GRCm39) S65T probably damaging Het
Cfap54 T C 10: 92,834,902 (GRCm39) D1101G possibly damaging Het
Cmpk2 G T 12: 26,524,144 (GRCm39) V314L possibly damaging Het
Fbxl8 A C 8: 105,995,523 (GRCm39) D345A probably benign Het
Gys2 T A 6: 142,402,035 (GRCm39) H268L probably benign Het
Hecw1 T A 13: 14,491,403 (GRCm39) R117* probably null Het
Hoxd10 G A 2: 74,522,984 (GRCm39) A221T probably benign Het
Hspa13 A T 16: 75,562,085 (GRCm39) L38Q probably damaging Het
Inava G T 1: 136,153,927 (GRCm39) A87E probably damaging Het
Ipo11 A G 13: 107,002,371 (GRCm39) probably null Het
Itgb8 A G 12: 119,137,133 (GRCm39) V390A possibly damaging Het
Kalrn T A 16: 34,003,117 (GRCm39) I1370F probably damaging Het
Macf1 T C 4: 123,276,485 (GRCm39) N6086S probably damaging Het
Ms4a13 T C 19: 11,170,303 (GRCm39) T14A probably benign Het
Or11g26 T A 14: 50,753,008 (GRCm39) C116S probably benign Het
Or55b10 A T 7: 102,143,628 (GRCm39) I118N probably damaging Het
Or5ac22 C T 16: 59,135,713 (GRCm39) R19H probably benign Het
Or5d37 A G 2: 87,923,413 (GRCm39) F289S probably damaging Het
Or8b47 A T 9: 38,435,300 (GRCm39) I91F probably benign Het
Or9q1 T A 19: 13,805,821 (GRCm39) probably benign Het
Patl2 T A 2: 122,016,645 (GRCm39) probably benign Het
Pcdhga7 T C 18: 37,850,059 (GRCm39) S689P probably benign Het
Pitpnc1 G T 11: 107,117,058 (GRCm39) Y227* probably null Het
Pla2g2e T C 4: 138,607,984 (GRCm39) V22A unknown Het
Ppil1 C A 17: 29,480,852 (GRCm39) V24F probably benign Het
Prl3b1 G A 13: 27,431,957 (GRCm39) probably null Het
Rabgef1 G A 5: 130,219,885 (GRCm39) probably null Het
Rhot2 A T 17: 26,059,886 (GRCm39) W341R probably damaging Het
Rps6kc1 A T 1: 190,482,381 (GRCm39) W286R probably benign Het
Rrs1 A G 1: 9,616,601 (GRCm39) T285A probably damaging Het
Shc3 T A 13: 51,597,009 (GRCm39) D338V possibly damaging Het
Siglech A T 7: 55,418,211 (GRCm39) M60L probably benign Het
Slc12a6 G T 2: 112,183,280 (GRCm39) V756F probably damaging Het
Slc43a2 G A 11: 75,462,681 (GRCm39) G507D probably damaging Het
Slf1 A G 13: 77,197,248 (GRCm39) S789P probably benign Het
Spata31d1d C A 13: 59,873,871 (GRCm39) M1221I probably benign Het
Srgap1 T C 10: 121,628,276 (GRCm39) N899D probably benign Het
Stag1 G A 9: 100,769,473 (GRCm39) M529I probably benign Het
Tekt3 A G 11: 62,972,085 (GRCm39) D247G probably benign Het
Tmppe A T 9: 114,234,312 (GRCm39) M204L probably benign Het
Tpsg1 G A 17: 25,588,271 (GRCm39) probably benign Het
Ttn A G 2: 76,628,315 (GRCm39) V6288A probably benign Het
Ttn A T 2: 76,723,444 (GRCm39) probably benign Het
Twsg1 C A 17: 66,244,799 (GRCm39) V73F probably damaging Het
Vmn2r102 A G 17: 19,914,450 (GRCm39) T672A probably damaging Het
Vps36 A G 8: 22,692,320 (GRCm39) I66V probably benign Het
Zbbx T A 3: 75,043,761 (GRCm39) Q162L probably damaging Het
Zfp560 T A 9: 20,259,297 (GRCm39) I522L probably benign Het
Zscan20 T C 4: 128,479,539 (GRCm39) N984S probably damaging Het
Other mutations in Xrcc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01376:Xrcc4 APN 13 90,210,169 (GRCm39) missense probably benign 0.00
IGL01486:Xrcc4 APN 13 90,210,151 (GRCm39) nonsense probably null
R0624:Xrcc4 UTSW 13 90,140,594 (GRCm39) missense possibly damaging 0.81
R0629:Xrcc4 UTSW 13 90,149,024 (GRCm39) splice site probably benign
R1801:Xrcc4 UTSW 13 90,140,698 (GRCm39) missense probably damaging 1.00
R2567:Xrcc4 UTSW 13 90,210,261 (GRCm39) missense probably damaging 0.99
R3055:Xrcc4 UTSW 13 90,210,196 (GRCm39) missense probably benign 0.06
R3056:Xrcc4 UTSW 13 90,210,196 (GRCm39) missense probably benign 0.06
R3941:Xrcc4 UTSW 13 90,219,752 (GRCm39) missense probably benign 0.01
R4486:Xrcc4 UTSW 13 90,140,707 (GRCm39) missense possibly damaging 0.79
R4556:Xrcc4 UTSW 13 90,140,623 (GRCm39) missense probably benign 0.02
R4599:Xrcc4 UTSW 13 90,210,126 (GRCm39) critical splice donor site probably null
R6057:Xrcc4 UTSW 13 90,139,198 (GRCm39) missense possibly damaging 0.95
R6262:Xrcc4 UTSW 13 89,926,906 (GRCm39) missense probably benign 0.00
R9080:Xrcc4 UTSW 13 90,149,097 (GRCm39) missense probably damaging 0.99
R9535:Xrcc4 UTSW 13 90,089,118 (GRCm39) missense probably benign 0.00
Z1176:Xrcc4 UTSW 13 90,089,161 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGGTTAATGCCCTCCTGC -3'
(R):5'- ATGTTCCCTGCACTGTATATGG -3'

Sequencing Primer
(F):5'- AATGGTTAATGCCCTCCTGCAATAC -3'
(R):5'- CCCTGCACTGTATATGGTAAGTACAG -3'
Posted On 2018-06-22