Incidental Mutation 'R6597:Ipo11'
ID524977
Institutional Source Beutler Lab
Gene Symbol Ipo11
Ensembl Gene ENSMUSG00000042590
Gene Nameimportin 11
SynonymsRanbp11, 1700081H05Rik, 2510001A17Rik, E330021B14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6597 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location106794439-106936958 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 106865863 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080856] [ENSMUST00000186033]
Predicted Effect probably null
Transcript: ENSMUST00000080856
SMART Domains Protein: ENSMUSP00000079667
Gene: ENSMUSG00000042590

DomainStartEndE-ValueType
IBN_N 28 100 7.71e-12 SMART
low complexity region 375 382 N/A INTRINSIC
low complexity region 563 570 N/A INTRINSIC
low complexity region 845 856 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186005
Predicted Effect probably null
Transcript: ENSMUST00000186033
SMART Domains Protein: ENSMUSP00000140046
Gene: ENSMUSG00000042590

DomainStartEndE-ValueType
IBN_N 28 100 7.71e-12 SMART
low complexity region 375 382 N/A INTRINSIC
low complexity region 563 570 N/A INTRINSIC
low complexity region 854 865 N/A INTRINSIC
Meta Mutation Damage Score 0.9493 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Importins, including IPO11, are a members of the karyopherin/importin-beta family of transport receptors (see KPNB1; 602738) that mediate nucleocytoplasmic transport of protein and RNA cargoes (Plafker and Macara, 2000 [PubMed 11032817]).[supplied by OMIM, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik G T 1: 136,226,189 A87E probably damaging Het
A2m A G 6: 121,648,121 Y486C probably damaging Het
Asb17 A T 3: 153,844,684 T118S probably damaging Het
Atl2 T A 17: 79,852,766 D293V possibly damaging Het
Bbs1 T A 19: 4,899,306 M242L probably benign Het
Btg1 T A 10: 96,618,320 S65T probably damaging Het
Cfap54 T C 10: 92,999,040 D1101G possibly damaging Het
Cmpk2 G T 12: 26,474,145 V314L possibly damaging Het
Fbxl8 A C 8: 105,268,891 D345A probably benign Het
Gys2 T A 6: 142,456,309 H268L probably benign Het
Hecw1 T A 13: 14,316,818 R117* probably null Het
Hoxd10 G A 2: 74,692,640 A221T probably benign Het
Hspa13 A T 16: 75,765,197 L38Q probably damaging Het
Itgb8 A G 12: 119,173,398 V390A possibly damaging Het
Kalrn T A 16: 34,182,747 I1370F probably damaging Het
Macf1 T C 4: 123,382,692 N6086S probably damaging Het
Ms4a13 T C 19: 11,192,939 T14A probably benign Het
Olfr1164 A G 2: 88,093,069 F289S probably damaging Het
Olfr1500 T A 19: 13,828,457 probably benign Het
Olfr204 C T 16: 59,315,350 R19H probably benign Het
Olfr545 A T 7: 102,494,421 I118N probably damaging Het
Olfr742 T A 14: 50,515,551 C116S probably benign Het
Olfr911-ps1 A T 9: 38,524,004 I91F probably benign Het
Patl2 T A 2: 122,186,164 probably benign Het
Pcdhga7 T C 18: 37,717,006 S689P probably benign Het
Pitpnc1 G T 11: 107,226,232 Y227* probably null Het
Pla2g2e T C 4: 138,880,673 V22A unknown Het
Ppil1 C A 17: 29,261,878 V24F probably benign Het
Prl3b1 G A 13: 27,247,974 probably null Het
Rabgef1 G A 5: 130,191,044 probably null Het
Rhot2 A T 17: 25,840,912 W341R probably damaging Het
Rps6kc1 A T 1: 190,750,184 W286R probably benign Het
Rrs1 A G 1: 9,546,376 T285A probably damaging Het
Shc3 T A 13: 51,442,973 D338V possibly damaging Het
Siglech A T 7: 55,768,463 M60L probably benign Het
Slc12a6 G T 2: 112,352,935 V756F probably damaging Het
Slc43a2 G A 11: 75,571,855 G507D probably damaging Het
Slf1 A G 13: 77,049,129 S789P probably benign Het
Spata31d1d C A 13: 59,726,057 M1221I probably benign Het
Srgap1 T C 10: 121,792,371 N899D probably benign Het
Stag1 G A 9: 100,887,420 M529I probably benign Het
Tekt3 A G 11: 63,081,259 D247G probably benign Het
Tmppe A T 9: 114,405,244 M204L probably benign Het
Tpsg1 G A 17: 25,369,297 probably benign Het
Ttn A G 2: 76,797,971 V6288A probably benign Het
Ttn A T 2: 76,893,100 probably benign Het
Twsg1 C A 17: 65,937,804 V73F probably damaging Het
Vmn2r102 A G 17: 19,694,188 T672A probably damaging Het
Vps36 A G 8: 22,202,304 I66V probably benign Het
Xrcc4 A T 13: 90,000,929 D157E probably benign Het
Zbbx T A 3: 75,136,454 Q162L probably damaging Het
Zfp560 T A 9: 20,348,001 I522L probably benign Het
Zscan20 T C 4: 128,585,746 N984S probably damaging Het
Other mutations in Ipo11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Ipo11 APN 13 106897260 missense probably damaging 1.00
IGL00900:Ipo11 APN 13 106847444 missense possibly damaging 0.81
IGL00971:Ipo11 APN 13 106856769 missense probably damaging 1.00
IGL01023:Ipo11 APN 13 106897259 missense probably benign 0.44
IGL01331:Ipo11 APN 13 106795746 missense possibly damaging 0.92
IGL01608:Ipo11 APN 13 106834494 intron probably benign
IGL02021:Ipo11 APN 13 106857237 missense probably damaging 1.00
IGL02620:Ipo11 APN 13 106876281 critical splice acceptor site probably null
IGL02651:Ipo11 APN 13 106875606 missense probably damaging 1.00
IGL02699:Ipo11 APN 13 106889397 missense possibly damaging 0.94
IGL02928:Ipo11 APN 13 106889355 splice site probably benign
R0017:Ipo11 UTSW 13 106886730 missense probably benign 0.00
R0017:Ipo11 UTSW 13 106886730 missense probably benign 0.00
R0032:Ipo11 UTSW 13 106834463 intron probably benign
R0164:Ipo11 UTSW 13 106910194 splice site probably benign
R0333:Ipo11 UTSW 13 106870763 missense probably benign 0.00
R0499:Ipo11 UTSW 13 106925087 missense probably benign 0.00
R0555:Ipo11 UTSW 13 106892461 missense probably damaging 1.00
R0718:Ipo11 UTSW 13 106919611 missense possibly damaging 0.91
R0899:Ipo11 UTSW 13 106900816 nonsense probably null
R1590:Ipo11 UTSW 13 106886717 missense probably damaging 1.00
R1700:Ipo11 UTSW 13 106795662 missense probably benign
R1851:Ipo11 UTSW 13 106812257 missense possibly damaging 0.73
R1852:Ipo11 UTSW 13 106812257 missense possibly damaging 0.73
R1853:Ipo11 UTSW 13 106860887 missense probably benign 0.19
R2012:Ipo11 UTSW 13 106919622 missense probably benign 0.01
R2168:Ipo11 UTSW 13 106879610 splice site probably null
R2183:Ipo11 UTSW 13 106925087 missense probably benign 0.00
R4254:Ipo11 UTSW 13 106892509 missense probably benign 0.00
R4607:Ipo11 UTSW 13 106900811 missense probably damaging 0.98
R4610:Ipo11 UTSW 13 106879737 missense probably benign 0.06
R4654:Ipo11 UTSW 13 106834184 intron probably benign
R4792:Ipo11 UTSW 13 106834160 intron probably benign
R4990:Ipo11 UTSW 13 106860887 missense probably benign 0.19
R5309:Ipo11 UTSW 13 106833973 intron probably benign
R5580:Ipo11 UTSW 13 106900747 missense probably benign
R5822:Ipo11 UTSW 13 106848418 unclassified probably benign
R6459:Ipo11 UTSW 13 106865769 intron probably null
R6803:Ipo11 UTSW 13 106857258 missense probably benign
R6882:Ipo11 UTSW 13 106900682 splice site probably null
R7071:Ipo11 UTSW 13 106925096 missense probably damaging 1.00
R7202:Ipo11 UTSW 13 106875570 missense probably damaging 1.00
R7214:Ipo11 UTSW 13 106895857 missense probably null
R7221:Ipo11 UTSW 13 106892557 missense probably damaging 1.00
R7392:Ipo11 UTSW 13 106891691 nonsense probably null
R7871:Ipo11 UTSW 13 106892468 missense probably benign 0.01
R7954:Ipo11 UTSW 13 106892468 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCTGTCTATCAGGAGCCTACAG -3'
(R):5'- CTTTGCTAGTATAATGAGGGCTATG -3'

Sequencing Primer
(F):5'- TCTATCAGGAGCCTACAGGGAAC -3'
(R):5'- GCTAGTATAATGAGGGCTATGTTAAG -3'
Posted On2018-06-22