Incidental Mutation 'R6629:Zp3'
ID 524980
Institutional Source Beutler Lab
Gene Symbol Zp3
Ensembl Gene ENSMUSG00000004948
Gene Name zona pellucida glycoprotein 3
Synonyms Zp-3
MMRRC Submission 044751-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.136) question?
Stock # R6629 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 136008959-136017478 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 136016190 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 306 (T306A)
Ref Sequence ENSEMBL: ENSMUSP00000005073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005073]
AlphaFold P10761
PDB Structure ZP-N domain of mammalian sperm receptor ZP3 (crystal form I) [X-RAY DIFFRACTION]
ZP-N domain of mammalian sperm receptor ZP3 (crystal form II) [X-RAY DIFFRACTION]
ZP-N domain of mammalian sperm receptor ZP3 (crystal form III) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000005073
AA Change: T306A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000005073
Gene: ENSMUSG00000004948
AA Change: T306A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
ZP 45 304 1.22e-68 SMART
low complexity region 320 334 N/A INTRINSIC
transmembrane domain 387 409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131563
SMART Domains Protein: ENSMUSP00000120447
Gene: ENSMUSG00000004948

DomainStartEndE-ValueType
Pfam:Zona_pellucida 35 136 6.4e-16 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The zona pellucida is an extracellular matrix that surrounds the oocyte and early embryo. It is composed primarily of three or four glycoproteins with various functions during fertilization and preimplantation development. The protein encoded by this gene is a structural component of the zona pellucida and functions in primary binding and induction of the sperm acrosome reaction. The nascent protein contains a N-terminal signal peptide sequence, a conserved ZP domain, a C-terminal consensus furin cleavage site, and a transmembrane domain. It is hypothesized that furin cleavage results in release of the mature protein from the plasma membrane for subsequent incorporation into the zona pellucida matrix. However, the requirement for furin cleavage in this process remains controversial based on mouse studies. A variation in the last exon of this gene has previously served as the basis for an additional ZP3 locus; however, sequence and literature review reveals that there is only one full-length ZP3 locus in the human genome. Another locus encoding a bipartite transcript designated POMZP3 contains a duplication of the last four exons of ZP3, including the above described variation, and maps closely to this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous female mutants are infertile. In these females oocytes lack a zona pellucida and cumulus-oocyte complexes are disrupted. Oocytes of heterozygous females have a thin zona, but females are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn3 A T 12: 101,903,665 (GRCm39) M180K probably benign Het
Bnip2 G T 9: 69,909,393 (GRCm39) R236L probably null Het
Boc T C 16: 44,312,724 (GRCm39) D582G probably benign Het
Cacul1 T C 19: 60,568,805 (GRCm39) S118G probably benign Het
Ccdc192 T C 18: 57,863,852 (GRCm39) S219P possibly damaging Het
Cpa2 A T 6: 30,554,193 (GRCm39) D271V probably damaging Het
Cubn G A 2: 13,435,683 (GRCm39) T1091M probably damaging Het
Dlgap2 A G 8: 14,881,465 (GRCm39) T846A probably benign Het
Eif5 G T 12: 111,510,042 (GRCm39) A329S probably damaging Het
Fam136b-ps G A 15: 31,276,962 (GRCm39) probably benign Het
Gnrhr A G 5: 86,330,168 (GRCm39) V284A probably benign Het
Grin3a A G 4: 49,844,991 (GRCm39) S31P probably damaging Het
Hectd2 T C 19: 36,592,938 (GRCm39) L701P probably damaging Het
Hook1 C T 4: 95,889,507 (GRCm39) T241I probably benign Het
Kif5a A G 10: 127,084,123 (GRCm39) V52A probably damaging Het
Lasp1 T A 11: 97,697,722 (GRCm39) Y11* probably null Het
Meltf A G 16: 31,703,894 (GRCm39) Y207C probably damaging Het
Mllt3 ACTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTACTACTACTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCT ACTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTACTACTACTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCT 4: 87,759,504 (GRCm39) probably benign Het
Nek1 A G 8: 61,507,367 (GRCm39) probably null Het
Notch2 C A 3: 98,028,197 (GRCm39) N969K possibly damaging Het
Or4c116 T A 2: 88,942,506 (GRCm39) M117L probably benign Het
Pcnx2 C T 8: 126,617,851 (GRCm39) G135R probably benign Het
Pla2g4f A T 2: 120,138,723 (GRCm39) L242Q probably damaging Het
Plcxd2 T G 16: 45,785,470 (GRCm39) T312P probably damaging Het
Prpf4 G A 4: 62,336,097 (GRCm39) V275I possibly damaging Het
Prpf8 G A 11: 75,386,252 (GRCm39) probably null Het
Pxn T C 5: 115,692,121 (GRCm39) L401P probably damaging Het
Rab44 A T 17: 29,354,754 (GRCm39) probably benign Het
Rfx6 C A 10: 51,601,586 (GRCm39) T669K probably benign Het
Rgs16 A G 1: 153,619,420 (GRCm39) N142S probably damaging Het
Rhobtb1 A G 10: 69,106,146 (GRCm39) E237G possibly damaging Het
Rsbn1 A C 3: 103,835,757 (GRCm39) D265A probably damaging Het
Rufy4 A G 1: 74,171,526 (GRCm39) probably null Het
Slc4a1 C A 11: 102,252,048 (GRCm39) E19* probably null Het
Tctn1 A G 5: 122,380,731 (GRCm39) S526P probably damaging Het
Tspear A T 10: 77,706,343 (GRCm39) H371L probably benign Het
Vmn1r34 A T 6: 66,614,499 (GRCm39) F80I probably benign Het
Wdr75 G A 1: 45,851,216 (GRCm39) S264N probably damaging Het
Zfp652 A T 11: 95,654,616 (GRCm39) N340Y probably damaging Het
Other mutations in Zp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02282:Zp3 APN 5 136,013,205 (GRCm39) missense possibly damaging 0.72
IGL02563:Zp3 APN 5 136,016,464 (GRCm39) critical splice donor site probably null
IGL03185:Zp3 APN 5 136,011,575 (GRCm39) missense possibly damaging 0.94
PIT4280001:Zp3 UTSW 5 136,013,318 (GRCm39) missense possibly damaging 0.56
R0646:Zp3 UTSW 5 136,013,210 (GRCm39) missense possibly damaging 0.46
R1454:Zp3 UTSW 5 136,013,042 (GRCm39) missense probably damaging 1.00
R1691:Zp3 UTSW 5 136,009,135 (GRCm39) missense possibly damaging 0.86
R3415:Zp3 UTSW 5 136,014,514 (GRCm39) missense probably benign 0.07
R4599:Zp3 UTSW 5 136,013,089 (GRCm39) nonsense probably null
R4987:Zp3 UTSW 5 136,016,359 (GRCm39) nonsense probably null
R5907:Zp3 UTSW 5 136,017,377 (GRCm39) missense probably benign 0.00
R6388:Zp3 UTSW 5 136,011,548 (GRCm39) missense probably benign 0.02
R6587:Zp3 UTSW 5 136,016,352 (GRCm39) missense possibly damaging 0.68
R7438:Zp3 UTSW 5 136,011,559 (GRCm39) missense probably damaging 1.00
R8050:Zp3 UTSW 5 136,011,604 (GRCm39) missense probably damaging 1.00
R8083:Zp3 UTSW 5 136,013,376 (GRCm39) missense probably damaging 1.00
R8158:Zp3 UTSW 5 136,014,418 (GRCm39) missense probably benign 0.15
R8421:Zp3 UTSW 5 136,017,331 (GRCm39) missense probably benign 0.00
R8447:Zp3 UTSW 5 136,013,244 (GRCm39) missense probably damaging 1.00
R8529:Zp3 UTSW 5 136,016,119 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGAATCGGCCCAAAAGTTAAATT -3'
(R):5'- GCAGCAATCACAGATGTCAGC -3'

Sequencing Primer
(F):5'- GCCTGAAACTTGCACTGTAG -3'
(R):5'- ATGTCAGCATCACCCTCTACTGG -3'
Posted On 2018-06-22