Incidental Mutation 'R6597:Rhot2'
ID524991
Institutional Source Beutler Lab
Gene Symbol Rhot2
Ensembl Gene ENSMUSG00000025733
Gene Nameras homolog family member T2
SynonymsMiro2, Arht2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R6597 (G1)
Quality Score215.009
Status Validated
Chromosome17
Chromosomal Location25838457-25844851 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25840912 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 341 (W341R)
Ref Sequence ENSEMBL: ENSMUSP00000044639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026831] [ENSMUST00000043897] [ENSMUST00000079461] [ENSMUST00000176709] [ENSMUST00000184865] [ENSMUST00000183929] [ENSMUST00000176923]
Predicted Effect probably benign
Transcript: ENSMUST00000026831
SMART Domains Protein: ENSMUSP00000026831
Gene: ENSMUSG00000025735

DomainStartEndE-ValueType
SCOP:d2mysb_ 13 74 5e-7 SMART
Blast:EFh 43 71 9e-11 BLAST
transmembrane domain 129 151 N/A INTRINSIC
Pfam:Rhomboid 174 331 6.7e-36 PFAM
transmembrane domain 339 361 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000043897
AA Change: W341R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044639
Gene: ENSMUSG00000025733
AA Change: W341R

DomainStartEndE-ValueType
Pfam:Roc 6 122 4.1e-11 PFAM
Pfam:Ras 6 168 2.3e-18 PFAM
EFh 188 216 1.27e1 SMART
Pfam:EF_assoc_2 219 305 2.2e-35 PFAM
EFh 308 336 1.23e-1 SMART
Pfam:EF_assoc_1 341 412 1.8e-25 PFAM
Blast:AAA 416 547 7e-18 BLAST
SCOP:d1mh1__ 422 532 4e-8 SMART
transmembrane domain 595 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079461
SMART Domains Protein: ENSMUSP00000078426
Gene: ENSMUSG00000073434

DomainStartEndE-ValueType
low complexity region 32 53 N/A INTRINSIC
Pfam:DUF667 60 183 5e-26 PFAM
Pfam:DUF667 210 271 3.7e-9 PFAM
low complexity region 381 396 N/A INTRINSIC
WD40 478 519 5.94e0 SMART
WD40 522 565 3.2e0 SMART
WD40 572 612 3.3e1 SMART
WD40 687 725 1.15e1 SMART
WD40 728 766 5.75e-1 SMART
WD40 768 808 9.24e-4 SMART
WD40 811 850 4.13e0 SMART
WD40 853 892 4.62e-1 SMART
WD40 950 993 1.07e1 SMART
WD40 996 1035 5.75e-1 SMART
WD40 1040 1077 1.58e-2 SMART
WD40 1290 1334 5.23e-3 SMART
WD40 1337 1378 1.27e-1 SMART
WD40 1384 1419 1.83e2 SMART
WD40 1422 1469 3.08e0 SMART
WD40 1472 1509 9.9e0 SMART
WD40 1568 1607 9.02e-7 SMART
WD40 1610 1655 5.75e-1 SMART
WD40 1659 1697 2.98e-1 SMART
WD40 1700 1749 6.14e1 SMART
WD40 1850 1888 1.92e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176583
Predicted Effect probably benign
Transcript: ENSMUST00000176591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176604
Predicted Effect unknown
Transcript: ENSMUST00000176751
AA Change: W130R
Predicted Effect probably benign
Transcript: ENSMUST00000176709
SMART Domains Protein: ENSMUSP00000135436
Gene: ENSMUSG00000025733

DomainStartEndE-ValueType
Pfam:Arf 1 121 1.6e-6 PFAM
Pfam:MMR_HSR1 6 118 1.4e-6 PFAM
Pfam:Miro 6 120 7.8e-20 PFAM
Pfam:Ras 6 121 7.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177122
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177062
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177347
Predicted Effect probably benign
Transcript: ENSMUST00000183929
SMART Domains Protein: ENSMUSP00000139046
Gene: ENSMUSG00000025735

DomainStartEndE-ValueType
SCOP:d2mysb_ 13 74 9e-6 SMART
Blast:EFh 43 70 2e-9 BLAST
transmembrane domain 136 155 N/A INTRINSIC
Pfam:Rhomboid 178 327 1e-27 PFAM
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176923
SMART Domains Protein: ENSMUSP00000135420
Gene: ENSMUSG00000073434

DomainStartEndE-ValueType
low complexity region 32 53 N/A INTRINSIC
Pfam:DUF667 60 252 5.1e-14 PFAM
low complexity region 363 378 N/A INTRINSIC
WD40 460 501 5.94e0 SMART
WD40 504 547 3.2e0 SMART
WD40 554 594 3.3e1 SMART
WD40 669 707 1.15e1 SMART
WD40 710 748 5.75e-1 SMART
WD40 750 790 9.24e-4 SMART
WD40 793 832 4.13e0 SMART
WD40 835 874 4.62e-1 SMART
WD40 932 975 1.07e1 SMART
WD40 978 1017 5.75e-1 SMART
WD40 1022 1059 1.58e-2 SMART
WD40 1272 1316 5.23e-3 SMART
WD40 1319 1360 1.27e-1 SMART
WD40 1366 1401 1.83e2 SMART
WD40 1404 1451 3.08e0 SMART
WD40 1454 1491 9.9e0 SMART
WD40 1550 1589 9.02e-7 SMART
WD40 1592 1637 5.75e-1 SMART
WD40 1641 1679 2.98e-1 SMART
WD40 1682 1731 6.14e1 SMART
WD40 1832 1870 1.92e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177470
Meta Mutation Damage Score 0.9639 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho family of GTPases. The encoded protein is localized to the outer mitochondrial membrane and plays a role in mitochondrial trafficking and fusion-fission dynamics. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile with normal mitochondria distribution in neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik G T 1: 136,226,189 A87E probably damaging Het
A2m A G 6: 121,648,121 Y486C probably damaging Het
Asb17 A T 3: 153,844,684 T118S probably damaging Het
Atl2 T A 17: 79,852,766 D293V possibly damaging Het
Bbs1 T A 19: 4,899,306 M242L probably benign Het
Btg1 T A 10: 96,618,320 S65T probably damaging Het
Cfap54 T C 10: 92,999,040 D1101G possibly damaging Het
Cmpk2 G T 12: 26,474,145 V314L possibly damaging Het
Fbxl8 A C 8: 105,268,891 D345A probably benign Het
Gys2 T A 6: 142,456,309 H268L probably benign Het
Hecw1 T A 13: 14,316,818 R117* probably null Het
Hoxd10 G A 2: 74,692,640 A221T probably benign Het
Hspa13 A T 16: 75,765,197 L38Q probably damaging Het
Ipo11 A G 13: 106,865,863 probably null Het
Itgb8 A G 12: 119,173,398 V390A possibly damaging Het
Kalrn T A 16: 34,182,747 I1370F probably damaging Het
Macf1 T C 4: 123,382,692 N6086S probably damaging Het
Ms4a13 T C 19: 11,192,939 T14A probably benign Het
Olfr1164 A G 2: 88,093,069 F289S probably damaging Het
Olfr1500 T A 19: 13,828,457 probably benign Het
Olfr204 C T 16: 59,315,350 R19H probably benign Het
Olfr545 A T 7: 102,494,421 I118N probably damaging Het
Olfr742 T A 14: 50,515,551 C116S probably benign Het
Olfr911-ps1 A T 9: 38,524,004 I91F probably benign Het
Patl2 T A 2: 122,186,164 probably benign Het
Pcdhga7 T C 18: 37,717,006 S689P probably benign Het
Pitpnc1 G T 11: 107,226,232 Y227* probably null Het
Pla2g2e T C 4: 138,880,673 V22A unknown Het
Ppil1 C A 17: 29,261,878 V24F probably benign Het
Prl3b1 G A 13: 27,247,974 probably null Het
Rabgef1 G A 5: 130,191,044 probably null Het
Rps6kc1 A T 1: 190,750,184 W286R probably benign Het
Rrs1 A G 1: 9,546,376 T285A probably damaging Het
Shc3 T A 13: 51,442,973 D338V possibly damaging Het
Siglech A T 7: 55,768,463 M60L probably benign Het
Slc12a6 G T 2: 112,352,935 V756F probably damaging Het
Slc43a2 G A 11: 75,571,855 G507D probably damaging Het
Slf1 A G 13: 77,049,129 S789P probably benign Het
Spata31d1d C A 13: 59,726,057 M1221I probably benign Het
Srgap1 T C 10: 121,792,371 N899D probably benign Het
Stag1 G A 9: 100,887,420 M529I probably benign Het
Tekt3 A G 11: 63,081,259 D247G probably benign Het
Tmppe A T 9: 114,405,244 M204L probably benign Het
Tpsg1 G A 17: 25,369,297 probably benign Het
Ttn A G 2: 76,797,971 V6288A probably benign Het
Ttn A T 2: 76,893,100 probably benign Het
Twsg1 C A 17: 65,937,804 V73F probably damaging Het
Vmn2r102 A G 17: 19,694,188 T672A probably damaging Het
Vps36 A G 8: 22,202,304 I66V probably benign Het
Xrcc4 A T 13: 90,000,929 D157E probably benign Het
Zbbx T A 3: 75,136,454 Q162L probably damaging Het
Zfp560 T A 9: 20,348,001 I522L probably benign Het
Zscan20 T C 4: 128,585,746 N984S probably damaging Het
Other mutations in Rhot2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Rhot2 APN 17 25841360 critical splice donor site probably null
IGL02707:Rhot2 APN 17 25844296 missense probably damaging 1.00
IGL03087:Rhot2 APN 17 25841141 unclassified probably benign
Endless UTSW 17 25840912 missense probably damaging 1.00
eternal UTSW 17 25842428 splice site probably null
ewige UTSW 17 25839420 missense possibly damaging 0.69
R0634:Rhot2 UTSW 17 25842028 missense possibly damaging 0.71
R1233:Rhot2 UTSW 17 25844097 missense probably damaging 1.00
R1436:Rhot2 UTSW 17 25841400 missense probably benign 0.16
R2902:Rhot2 UTSW 17 25843976 missense probably damaging 0.99
R3617:Rhot2 UTSW 17 25840981 unclassified probably benign
R3767:Rhot2 UTSW 17 25840547 missense probably benign 0.11
R3768:Rhot2 UTSW 17 25840547 missense probably benign 0.11
R3769:Rhot2 UTSW 17 25840547 missense probably benign 0.11
R3770:Rhot2 UTSW 17 25840547 missense probably benign 0.11
R4362:Rhot2 UTSW 17 25842091 missense probably damaging 1.00
R4487:Rhot2 UTSW 17 25839493 missense probably benign 0.01
R4670:Rhot2 UTSW 17 25841331 unclassified probably benign
R4749:Rhot2 UTSW 17 25844274 missense probably damaging 1.00
R5772:Rhot2 UTSW 17 25839807 missense probably benign 0.00
R5840:Rhot2 UTSW 17 25840058 missense probably benign
R5993:Rhot2 UTSW 17 25841111 missense probably benign 0.45
R6479:Rhot2 UTSW 17 25841080 missense probably benign 0.22
R6523:Rhot2 UTSW 17 25839420 missense possibly damaging 0.69
R7269:Rhot2 UTSW 17 25842428 splice site probably null
R7427:Rhot2 UTSW 17 25841609 missense probably damaging 1.00
R7479:Rhot2 UTSW 17 25840749 missense probably damaging 1.00
R7672:Rhot2 UTSW 17 25843105 critical splice donor site probably null
R8176:Rhot2 UTSW 17 25844094 missense probably damaging 1.00
R8258:Rhot2 UTSW 17 25839890 missense probably benign 0.00
R8259:Rhot2 UTSW 17 25839890 missense probably benign 0.00
X0067:Rhot2 UTSW 17 25841466 missense possibly damaging 0.84
Y5409:Rhot2 UTSW 17 25844295 missense probably damaging 1.00
Z1177:Rhot2 UTSW 17 25840683 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAACCCAGGTAGCCAAGGTG -3'
(R):5'- TCGTGGCTACCAGTTTGTGC -3'

Sequencing Primer
(F):5'- CATTGCTGGACATCCAAGTAGGTC -3'
(R):5'- CTACCAGTTTGTGCAGCGG -3'
Posted On2018-06-22