Incidental Mutation 'R6597:Twsg1'
ID524995
Institutional Source Beutler Lab
Gene Symbol Twsg1
Ensembl Gene ENSMUSG00000024098
Gene Nametwisted gastrulation BMP signaling modulator 1
Synonyms1810013J15Rik, D17Ertd403e, 9030422N06Rik, Tsg
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.549) question?
Stock #R6597 (G1)
Quality Score194.009
Status Validated
Chromosome17
Chromosomal Location65923066-65951187 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 65937804 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 73 (V73F)
Ref Sequence ENSEMBL: ENSMUSP00000024906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024906]
Predicted Effect probably damaging
Transcript: ENSMUST00000024906
AA Change: V73F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000024906
Gene: ENSMUSG00000024098
AA Change: V73F

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Tsg 85 221 3.6e-49 PFAM
Meta Mutation Damage Score 0.3669 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Homozygous null mice appear healthy at birth, but more than half of the progeny fail to thrive and exhibit dwarfism with delayed ossification and immune system. These defects result in premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik G T 1: 136,226,189 A87E probably damaging Het
A2m A G 6: 121,648,121 Y486C probably damaging Het
Asb17 A T 3: 153,844,684 T118S probably damaging Het
Atl2 T A 17: 79,852,766 D293V possibly damaging Het
Bbs1 T A 19: 4,899,306 M242L probably benign Het
Btg1 T A 10: 96,618,320 S65T probably damaging Het
Cfap54 T C 10: 92,999,040 D1101G possibly damaging Het
Cmpk2 G T 12: 26,474,145 V314L possibly damaging Het
Fbxl8 A C 8: 105,268,891 D345A probably benign Het
Gys2 T A 6: 142,456,309 H268L probably benign Het
Hecw1 T A 13: 14,316,818 R117* probably null Het
Hoxd10 G A 2: 74,692,640 A221T probably benign Het
Hspa13 A T 16: 75,765,197 L38Q probably damaging Het
Ipo11 A G 13: 106,865,863 probably null Het
Itgb8 A G 12: 119,173,398 V390A possibly damaging Het
Kalrn T A 16: 34,182,747 I1370F probably damaging Het
Macf1 T C 4: 123,382,692 N6086S probably damaging Het
Ms4a13 T C 19: 11,192,939 T14A probably benign Het
Olfr1164 A G 2: 88,093,069 F289S probably damaging Het
Olfr1500 T A 19: 13,828,457 probably benign Het
Olfr204 C T 16: 59,315,350 R19H probably benign Het
Olfr545 A T 7: 102,494,421 I118N probably damaging Het
Olfr742 T A 14: 50,515,551 C116S probably benign Het
Olfr911-ps1 A T 9: 38,524,004 I91F probably benign Het
Patl2 T A 2: 122,186,164 probably benign Het
Pcdhga7 T C 18: 37,717,006 S689P probably benign Het
Pitpnc1 G T 11: 107,226,232 Y227* probably null Het
Pla2g2e T C 4: 138,880,673 V22A unknown Het
Ppil1 C A 17: 29,261,878 V24F probably benign Het
Prl3b1 G A 13: 27,247,974 probably null Het
Rabgef1 G A 5: 130,191,044 probably null Het
Rhot2 A T 17: 25,840,912 W341R probably damaging Het
Rps6kc1 A T 1: 190,750,184 W286R probably benign Het
Rrs1 A G 1: 9,546,376 T285A probably damaging Het
Shc3 T A 13: 51,442,973 D338V possibly damaging Het
Siglech A T 7: 55,768,463 M60L probably benign Het
Slc12a6 G T 2: 112,352,935 V756F probably damaging Het
Slc43a2 G A 11: 75,571,855 G507D probably damaging Het
Slf1 A G 13: 77,049,129 S789P probably benign Het
Spata31d1d C A 13: 59,726,057 M1221I probably benign Het
Srgap1 T C 10: 121,792,371 N899D probably benign Het
Stag1 G A 9: 100,887,420 M529I probably benign Het
Tekt3 A G 11: 63,081,259 D247G probably benign Het
Tmppe A T 9: 114,405,244 M204L probably benign Het
Tpsg1 G A 17: 25,369,297 probably benign Het
Ttn A G 2: 76,797,971 V6288A probably benign Het
Ttn A T 2: 76,893,100 probably benign Het
Vmn2r102 A G 17: 19,694,188 T672A probably damaging Het
Vps36 A G 8: 22,202,304 I66V probably benign Het
Xrcc4 A T 13: 90,000,929 D157E probably benign Het
Zbbx T A 3: 75,136,454 Q162L probably damaging Het
Zfp560 T A 9: 20,348,001 I522L probably benign Het
Zscan20 T C 4: 128,585,746 N984S probably damaging Het
Other mutations in Twsg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Twsg1 APN 17 65948651 splice site probably benign
IGL01313:Twsg1 APN 17 65948704 missense probably damaging 1.00
IGL01752:Twsg1 APN 17 65929784 missense probably benign 0.04
IGL02326:Twsg1 APN 17 65926436 missense possibly damaging 0.75
PIT4791001:Twsg1 UTSW 17 65929711 missense probably benign 0.03
R3983:Twsg1 UTSW 17 65929763 missense probably benign 0.20
R4328:Twsg1 UTSW 17 65948738 missense probably benign
R4447:Twsg1 UTSW 17 65929787 missense possibly damaging 0.58
R4449:Twsg1 UTSW 17 65926310 missense possibly damaging 0.88
R4625:Twsg1 UTSW 17 65929551 missense probably benign 0.00
R7265:Twsg1 UTSW 17 65929787 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- CAGCTTCAACCTAAAAGGAAGG -3'
(R):5'- TGGGGACGTTATATAAATTCCAGTAGG -3'

Sequencing Primer
(F):5'- CTTCAACCTAAAAGGAAGGGCAGC -3'
(R):5'- AGATCCCCTTTAACTGGAGTTGCAG -3'
Posted On2018-06-22