Incidental Mutation 'R6597:Pcdhga7'
ID524999
Institutional Source Beutler Lab
Gene Symbol Pcdhga7
Ensembl Gene ENSMUSG00000103472
Gene Nameprotocadherin gamma subfamily A, 7
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R6597 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location37714764-37841873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37717006 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 689 (S689P)
Ref Sequence ENSEMBL: ENSMUSP00000142126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073447] [ENSMUST00000115661] [ENSMUST00000192511] [ENSMUST00000192931] [ENSMUST00000193414] [ENSMUST00000193476] [ENSMUST00000193869] [ENSMUST00000194190] [ENSMUST00000194418] [ENSMUST00000194544] [ENSMUST00000195112] [ENSMUST00000195363] [ENSMUST00000195823]
Predicted Effect probably benign
Transcript: ENSMUST00000073447
SMART Domains Protein: ENSMUSP00000073150
Gene: ENSMUSG00000104346

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
CA 42 128 2.15e-2 SMART
CA 152 237 4.8e-13 SMART
CA 261 342 9.36e-25 SMART
CA 366 447 6.62e-25 SMART
CA 471 557 6.72e-26 SMART
CA 588 666 2.15e-15 SMART
Pfam:Cadherin_C_2 685 768 4.8e-24 PFAM
Pfam:Cadherin_tail 805 928 8.1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192511
AA Change: S689P

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000141704
Gene: ENSMUSG00000103472
AA Change: S689P

DomainStartEndE-ValueType
CA 47 133 1.57e-2 SMART
CA 157 242 3.24e-19 SMART
CA 266 347 3.21e-23 SMART
CA 371 452 9.08e-23 SMART
CA 476 562 1.32e-24 SMART
CA 593 671 3.5e-15 SMART
transmembrane domain 694 716 N/A INTRINSIC
low complexity region 916 935 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192931
SMART Domains Protein: ENSMUSP00000141348
Gene: ENSMUSG00000103037

DomainStartEndE-ValueType
CA 36 119 8e-3 SMART
CA 143 228 1.34e-20 SMART
CA 252 333 1.52e-24 SMART
CA 357 438 9.22e-24 SMART
CA 462 548 1.24e-24 SMART
CA 579 660 1.3e-9 SMART
transmembrane domain 679 701 N/A INTRINSIC
low complexity region 899 918 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193414
SMART Domains Protein: ENSMUSP00000141893
Gene: ENSMUSG00000103567

DomainStartEndE-ValueType
CA 45 131 2.45e-1 SMART
CA 155 240 1.05e-18 SMART
CA 264 345 6.52e-24 SMART
CA 369 450 5.99e-23 SMART
CA 474 560 6.99e-24 SMART
CA 591 669 5.31e-15 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193476
AA Change: S689P

PolyPhen 2 Score 0.242 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142126
Gene: ENSMUSG00000103472
AA Change: S689P

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
CA 47 133 7.6e-5 SMART
CA 157 242 1.6e-21 SMART
CA 266 347 1.6e-25 SMART
CA 371 452 4.5e-25 SMART
CA 476 562 6.6e-27 SMART
CA 593 671 1.7e-17 SMART
transmembrane domain 694 716 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193815
Predicted Effect probably benign
Transcript: ENSMUST00000193869
SMART Domains Protein: ENSMUSP00000141482
Gene: ENSMUSG00000103332

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 45 131 1.64e-2 SMART
CA 155 240 6.42e-23 SMART
CA 264 345 1.76e-20 SMART
CA 369 450 2.27e-23 SMART
CA 474 560 1.5e-23 SMART
CA 591 669 1.17e-16 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194190
SMART Domains Protein: ENSMUSP00000142062
Gene: ENSMUSG00000103144

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 31 131 3.16e-2 SMART
CA 155 240 5.39e-16 SMART
CA 264 345 6.72e-26 SMART
CA 369 450 1.32e-24 SMART
CA 474 560 4.17e-22 SMART
CA 591 669 4.48e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 912 931 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194418
SMART Domains Protein: ENSMUSP00000142140
Gene: ENSMUSG00000103677

DomainStartEndE-ValueType
CA 44 130 1.64e-2 SMART
CA 154 239 3.93e-18 SMART
CA 263 344 5.22e-23 SMART
CA 368 449 5.02e-25 SMART
CA 473 559 2.07e-26 SMART
CA 590 668 6.84e-18 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 911 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195069
Predicted Effect probably benign
Transcript: ENSMUST00000195112
SMART Domains Protein: ENSMUSP00000141449
Gene: ENSMUSG00000102748

DomainStartEndE-ValueType
CA 24 130 8.18e-3 SMART
CA 154 239 1.39e-18 SMART
CA 263 344 7.91e-23 SMART
CA 368 449 2.27e-23 SMART
CA 473 559 1.24e-24 SMART
CA 590 671 1.3e-9 SMART
transmembrane domain 690 712 N/A INTRINSIC
low complexity region 909 928 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195363
SMART Domains Protein: ENSMUSP00000142227
Gene: ENSMUSG00000103585

DomainStartEndE-ValueType
low complexity region 17 25 N/A INTRINSIC
CA 56 131 1.47e-2 SMART
CA 155 240 1.23e-19 SMART
CA 264 343 5.54e-27 SMART
CA 367 448 5.09e-26 SMART
CA 472 558 1.98e-23 SMART
CA 589 670 1.3e-9 SMART
transmembrane domain 689 711 N/A INTRINSIC
low complexity region 893 912 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195823
SMART Domains Protein: ENSMUSP00000141803
Gene: ENSMUSG00000103793

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
CA 45 131 2.41e-2 SMART
CA 155 240 5.77e-16 SMART
CA 264 345 1.1e-21 SMART
CA 369 450 2.75e-22 SMART
low complexity region 453 462 N/A INTRINSIC
CA 474 560 9.22e-24 SMART
CA 591 669 2.4e-13 SMART
transmembrane domain 692 714 N/A INTRINSIC
low complexity region 913 932 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik G T 1: 136,226,189 A87E probably damaging Het
A2m A G 6: 121,648,121 Y486C probably damaging Het
Asb17 A T 3: 153,844,684 T118S probably damaging Het
Atl2 T A 17: 79,852,766 D293V possibly damaging Het
Bbs1 T A 19: 4,899,306 M242L probably benign Het
Btg1 T A 10: 96,618,320 S65T probably damaging Het
Cfap54 T C 10: 92,999,040 D1101G possibly damaging Het
Cmpk2 G T 12: 26,474,145 V314L possibly damaging Het
Fbxl8 A C 8: 105,268,891 D345A probably benign Het
Gys2 T A 6: 142,456,309 H268L probably benign Het
Hecw1 T A 13: 14,316,818 R117* probably null Het
Hoxd10 G A 2: 74,692,640 A221T probably benign Het
Hspa13 A T 16: 75,765,197 L38Q probably damaging Het
Ipo11 A G 13: 106,865,863 probably null Het
Itgb8 A G 12: 119,173,398 V390A possibly damaging Het
Kalrn T A 16: 34,182,747 I1370F probably damaging Het
Macf1 T C 4: 123,382,692 N6086S probably damaging Het
Ms4a13 T C 19: 11,192,939 T14A probably benign Het
Olfr1164 A G 2: 88,093,069 F289S probably damaging Het
Olfr1500 T A 19: 13,828,457 probably benign Het
Olfr204 C T 16: 59,315,350 R19H probably benign Het
Olfr545 A T 7: 102,494,421 I118N probably damaging Het
Olfr742 T A 14: 50,515,551 C116S probably benign Het
Olfr911-ps1 A T 9: 38,524,004 I91F probably benign Het
Patl2 T A 2: 122,186,164 probably benign Het
Pitpnc1 G T 11: 107,226,232 Y227* probably null Het
Pla2g2e T C 4: 138,880,673 V22A unknown Het
Ppil1 C A 17: 29,261,878 V24F probably benign Het
Prl3b1 G A 13: 27,247,974 probably null Het
Rabgef1 G A 5: 130,191,044 probably null Het
Rhot2 A T 17: 25,840,912 W341R probably damaging Het
Rps6kc1 A T 1: 190,750,184 W286R probably benign Het
Rrs1 A G 1: 9,546,376 T285A probably damaging Het
Shc3 T A 13: 51,442,973 D338V possibly damaging Het
Siglech A T 7: 55,768,463 M60L probably benign Het
Slc12a6 G T 2: 112,352,935 V756F probably damaging Het
Slc43a2 G A 11: 75,571,855 G507D probably damaging Het
Slf1 A G 13: 77,049,129 S789P probably benign Het
Spata31d1d C A 13: 59,726,057 M1221I probably benign Het
Srgap1 T C 10: 121,792,371 N899D probably benign Het
Stag1 G A 9: 100,887,420 M529I probably benign Het
Tekt3 A G 11: 63,081,259 D247G probably benign Het
Tmppe A T 9: 114,405,244 M204L probably benign Het
Tpsg1 G A 17: 25,369,297 probably benign Het
Ttn A G 2: 76,797,971 V6288A probably benign Het
Ttn A T 2: 76,893,100 probably benign Het
Twsg1 C A 17: 65,937,804 V73F probably damaging Het
Vmn2r102 A G 17: 19,694,188 T672A probably damaging Het
Vps36 A G 8: 22,202,304 I66V probably benign Het
Xrcc4 A T 13: 90,000,929 D157E probably benign Het
Zbbx T A 3: 75,136,454 Q162L probably damaging Het
Zfp560 T A 9: 20,348,001 I522L probably benign Het
Zscan20 T C 4: 128,585,746 N984S probably damaging Het
Other mutations in Pcdhga7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3012:Pcdhga7 UTSW 18 37715638 missense probably benign 0.01
R3950:Pcdhga7 UTSW 18 37716515 missense probably damaging 1.00
R4697:Pcdhga7 UTSW 18 37717208 missense probably damaging 1.00
R4985:Pcdhga7 UTSW 18 37715645 missense probably benign 0.02
R5073:Pcdhga7 UTSW 18 37715972 missense probably damaging 1.00
R5137:Pcdhga7 UTSW 18 37717380 missense probably damaging 0.99
R5424:Pcdhga7 UTSW 18 37715335 missense probably benign 0.07
R5534:Pcdhga7 UTSW 18 37716278 missense probably damaging 1.00
R5619:Pcdhga7 UTSW 18 37715747 missense probably benign 0.00
R5689:Pcdhga7 UTSW 18 37716683 missense probably damaging 1.00
R6200:Pcdhga7 UTSW 18 37716082 missense probably damaging 0.99
R6235:Pcdhga7 UTSW 18 37716430 missense probably benign 0.27
R6684:Pcdhga7 UTSW 18 37716050 missense probably damaging 1.00
R6714:Pcdhga7 UTSW 18 37717277 missense probably benign 0.00
R6810:Pcdhga7 UTSW 18 37715873 missense probably benign 0.24
R6920:Pcdhga7 UTSW 18 37715146 missense probably benign 0.00
R6922:Pcdhga7 UTSW 18 37715657 missense probably damaging 0.99
R7051:Pcdhga7 UTSW 18 37716941 missense probably damaging 1.00
R7072:Pcdhga7 UTSW 18 37717276 missense probably benign 0.01
R7265:Pcdhga7 UTSW 18 37716916 missense probably damaging 1.00
R7397:Pcdhga7 UTSW 18 37717274 missense probably benign 0.04
R7450:Pcdhga7 UTSW 18 37716026 missense probably benign 0.27
R7451:Pcdhga7 UTSW 18 37716004 missense possibly damaging 0.67
R7790:Pcdhga7 UTSW 18 37714943 start codon destroyed probably null 0.85
R7833:Pcdhga7 UTSW 18 37716024 missense possibly damaging 0.52
R7916:Pcdhga7 UTSW 18 37716024 missense possibly damaging 0.52
R8007:Pcdhga7 UTSW 18 37716893 missense not run
R8073:Pcdhga7 UTSW 18 37715345 missense not run
Predicted Primers PCR Primer
(F):5'- TTAAAGCCAGTGAGCCAGG -3'
(R):5'- CTACAAAGTGTGAGGCAGGC -3'

Sequencing Primer
(F):5'- TTCTCAGTAGGGCTACACACTGG -3'
(R):5'- AGTGTGAGGCAGGCACATCTTC -3'
Posted On2018-06-22