Incidental Mutation 'R6597:Bbs1'
ID525000
Institutional Source Beutler Lab
Gene Symbol Bbs1
Ensembl Gene ENSMUSG00000006464
Gene NameBardet-Biedl syndrome 1 (human)
SynonymsD19Ertd609e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.821) question?
Stock #R6597 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location4886898-4906627 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4899306 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 242 (M242L)
Ref Sequence ENSEMBL: ENSMUSP00000055321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053506]
Predicted Effect probably benign
Transcript: ENSMUST00000053506
AA Change: M242L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000055321
Gene: ENSMUSG00000006464
AA Change: M242L

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Pfam:BBS1 23 276 2.7e-104 PFAM
low complexity region 293 305 N/A INTRINSIC
low complexity region 458 466 N/A INTRINSIC
Meta Mutation Damage Score 0.1370 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene have been observed in patients with the major form (type 1) of Bardet-Biedl syndrome. The encoded protein may play a role in eye, limb, cardiac and reproductive system development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display partial embryonic lethality, low body weight before weaning, obesity after weaning, retinal degeneration, and abnormal olfactory epithelium and neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik G T 1: 136,226,189 A87E probably damaging Het
A2m A G 6: 121,648,121 Y486C probably damaging Het
Asb17 A T 3: 153,844,684 T118S probably damaging Het
Atl2 T A 17: 79,852,766 D293V possibly damaging Het
Btg1 T A 10: 96,618,320 S65T probably damaging Het
Cfap54 T C 10: 92,999,040 D1101G possibly damaging Het
Cmpk2 G T 12: 26,474,145 V314L possibly damaging Het
Fbxl8 A C 8: 105,268,891 D345A probably benign Het
Gys2 T A 6: 142,456,309 H268L probably benign Het
Hecw1 T A 13: 14,316,818 R117* probably null Het
Hoxd10 G A 2: 74,692,640 A221T probably benign Het
Hspa13 A T 16: 75,765,197 L38Q probably damaging Het
Ipo11 A G 13: 106,865,863 probably null Het
Itgb8 A G 12: 119,173,398 V390A possibly damaging Het
Kalrn T A 16: 34,182,747 I1370F probably damaging Het
Macf1 T C 4: 123,382,692 N6086S probably damaging Het
Ms4a13 T C 19: 11,192,939 T14A probably benign Het
Olfr1164 A G 2: 88,093,069 F289S probably damaging Het
Olfr1500 T A 19: 13,828,457 probably benign Het
Olfr204 C T 16: 59,315,350 R19H probably benign Het
Olfr545 A T 7: 102,494,421 I118N probably damaging Het
Olfr742 T A 14: 50,515,551 C116S probably benign Het
Olfr911-ps1 A T 9: 38,524,004 I91F probably benign Het
Patl2 T A 2: 122,186,164 probably benign Het
Pcdhga7 T C 18: 37,717,006 S689P probably benign Het
Pitpnc1 G T 11: 107,226,232 Y227* probably null Het
Pla2g2e T C 4: 138,880,673 V22A unknown Het
Ppil1 C A 17: 29,261,878 V24F probably benign Het
Prl3b1 G A 13: 27,247,974 probably null Het
Rabgef1 G A 5: 130,191,044 probably null Het
Rhot2 A T 17: 25,840,912 W341R probably damaging Het
Rps6kc1 A T 1: 190,750,184 W286R probably benign Het
Rrs1 A G 1: 9,546,376 T285A probably damaging Het
Shc3 T A 13: 51,442,973 D338V possibly damaging Het
Siglech A T 7: 55,768,463 M60L probably benign Het
Slc12a6 G T 2: 112,352,935 V756F probably damaging Het
Slc43a2 G A 11: 75,571,855 G507D probably damaging Het
Slf1 A G 13: 77,049,129 S789P probably benign Het
Spata31d1d C A 13: 59,726,057 M1221I probably benign Het
Srgap1 T C 10: 121,792,371 N899D probably benign Het
Stag1 G A 9: 100,887,420 M529I probably benign Het
Tekt3 A G 11: 63,081,259 D247G probably benign Het
Tmppe A T 9: 114,405,244 M204L probably benign Het
Tpsg1 G A 17: 25,369,297 probably benign Het
Ttn A G 2: 76,797,971 V6288A probably benign Het
Ttn A T 2: 76,893,100 probably benign Het
Twsg1 C A 17: 65,937,804 V73F probably damaging Het
Vmn2r102 A G 17: 19,694,188 T672A probably damaging Het
Vps36 A G 8: 22,202,304 I66V probably benign Het
Xrcc4 A T 13: 90,000,929 D157E probably benign Het
Zbbx T A 3: 75,136,454 Q162L probably damaging Het
Zfp560 T A 9: 20,348,001 I522L probably benign Het
Zscan20 T C 4: 128,585,746 N984S probably damaging Het
Other mutations in Bbs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Bbs1 APN 19 4893010 missense probably benign
IGL01110:Bbs1 APN 19 4892925 missense possibly damaging 0.93
IGL01116:Bbs1 APN 19 4902839 splice site probably benign
IGL01480:Bbs1 APN 19 4894393 missense probably damaging 1.00
IGL01926:Bbs1 APN 19 4902863 missense probably benign 0.01
IGL02893:Bbs1 APN 19 4897576 nonsense probably null
IGL03136:Bbs1 APN 19 4890991 missense probably benign 0.10
IGL03342:Bbs1 APN 19 4897593 missense probably damaging 1.00
bookface UTSW 19 4897326 missense possibly damaging 0.81
PIT4131001:Bbs1 UTSW 19 4899259 missense possibly damaging 0.83
PIT4378001:Bbs1 UTSW 19 4891675 missense probably benign 0.05
PIT4468001:Bbs1 UTSW 19 4906162 missense probably benign 0.19
R0023:Bbs1 UTSW 19 4906014 missense probably damaging 1.00
R0023:Bbs1 UTSW 19 4906014 missense probably damaging 1.00
R0127:Bbs1 UTSW 19 4895029 missense probably benign 0.05
R1423:Bbs1 UTSW 19 4894263 missense probably benign 0.08
R1760:Bbs1 UTSW 19 4894322 missense probably benign 0.10
R1992:Bbs1 UTSW 19 4891708 missense probably benign
R2145:Bbs1 UTSW 19 4903707 missense possibly damaging 0.71
R4097:Bbs1 UTSW 19 4897317 missense probably damaging 1.00
R5717:Bbs1 UTSW 19 4897326 missense possibly damaging 0.81
R5947:Bbs1 UTSW 19 4892994 missense probably benign 0.27
R6005:Bbs1 UTSW 19 4903795 nonsense probably null
R6175:Bbs1 UTSW 19 4890721 missense probably damaging 1.00
R6734:Bbs1 UTSW 19 4903896 missense probably benign 0.10
R6772:Bbs1 UTSW 19 4906590 unclassified probably benign
R6805:Bbs1 UTSW 19 4900615 missense probably damaging 1.00
R6838:Bbs1 UTSW 19 4903852 missense possibly damaging 0.47
R7198:Bbs1 UTSW 19 4895015 missense probably damaging 0.97
R7276:Bbs1 UTSW 19 4897710 splice site probably null
R7685:Bbs1 UTSW 19 4906154 missense probably benign 0.43
R7696:Bbs1 UTSW 19 4890989 critical splice donor site probably null
R7933:Bbs1 UTSW 19 4891650 splice site probably benign
Y5404:Bbs1 UTSW 19 4900607 missense possibly damaging 0.49
Y5407:Bbs1 UTSW 19 4900607 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- GTCCTCATAGCAGGCTCTTAGC -3'
(R):5'- AGGTCTCCCTTGTTCAGACG -3'

Sequencing Primer
(F):5'- AAATGCTCAGCTCCTCTTTCAATC -3'
(R):5'- AGACGCCTTTATCTCTACTTACATCG -3'
Posted On2018-06-22