Incidental Mutation 'R6629:1700011I03Rik'
ID525020
Institutional Source Beutler Lab
Gene Symbol 1700011I03Rik
Ensembl Gene ENSMUSG00000058925
Gene NameRIKEN cDNA 1700011I03 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6629 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location57533780-57731065 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57730780 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 219 (S219P)
Ref Sequence ENSEMBL: ENSMUSP00000078674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079738] [ENSMUST00000135806]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079738
AA Change: S219P

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000078674
Gene: ENSMUSG00000058925
AA Change: S219P

DomainStartEndE-ValueType
coiled coil region 68 177 N/A INTRINSIC
coiled coil region 220 260 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000123872
AA Change: S201P
SMART Domains Protein: ENSMUSP00000114519
Gene: ENSMUSG00000058925
AA Change: S201P

DomainStartEndE-ValueType
low complexity region 14 19 N/A INTRINSIC
coiled coil region 50 159 N/A INTRINSIC
coiled coil region 202 242 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000135806
SMART Domains Protein: ENSMUSP00000115752
Gene: ENSMUSG00000058925

DomainStartEndE-ValueType
coiled coil region 68 151 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn3 A T 12: 101,937,406 M180K probably benign Het
Bnip2 G T 9: 70,002,111 R236L probably null Het
Boc T C 16: 44,492,361 D582G probably benign Het
Cacul1 T C 19: 60,580,367 S118G probably benign Het
Cpa2 A T 6: 30,554,194 D271V probably damaging Het
Cubn G A 2: 13,430,872 T1091M probably damaging Het
Dlgap2 A G 8: 14,831,465 T846A probably benign Het
Eif5 G T 12: 111,543,608 A329S probably damaging Het
Fam136b-ps G A 15: 31,276,816 probably benign Het
Gnrhr A G 5: 86,182,309 V284A probably benign Het
Grin3a A G 4: 49,844,991 S31P probably damaging Het
Hectd2 T C 19: 36,615,538 L701P probably damaging Het
Hook1 C T 4: 96,001,270 T241I probably benign Het
Kif5a A G 10: 127,248,254 V52A probably damaging Het
Lasp1 T A 11: 97,806,896 Y11* probably null Het
Meltf A G 16: 31,885,076 Y207C probably damaging Het
Mllt3 ACTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTACTACTACTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCT ACTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTACTACTACTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCT 4: 87,841,267 probably benign Het
Nek1 A G 8: 61,054,333 probably null Het
Notch2 C A 3: 98,120,881 N969K possibly damaging Het
Olfr1221 T A 2: 89,112,162 M117L probably benign Het
Pcnx2 C T 8: 125,891,112 G135R probably benign Het
Pla2g4f A T 2: 120,308,242 L242Q probably damaging Het
Plcxd2 T G 16: 45,965,107 T312P probably damaging Het
Prpf4 G A 4: 62,417,860 V275I possibly damaging Het
Prpf8 G A 11: 75,495,426 probably null Het
Pxn T C 5: 115,554,062 L401P probably damaging Het
Rab44 A T 17: 29,135,780 probably benign Het
Rfx6 C A 10: 51,725,490 T669K probably benign Het
Rgs16 A G 1: 153,743,674 N142S probably damaging Het
Rhobtb1 A G 10: 69,270,316 E237G possibly damaging Het
Rsbn1 A C 3: 103,928,441 D265A probably damaging Het
Rufy4 A G 1: 74,132,367 probably null Het
Slc4a1 C A 11: 102,361,222 E19* probably null Het
Tctn1 A G 5: 122,242,668 S526P probably damaging Het
Tspear A T 10: 77,870,509 H371L probably benign Het
Vmn1r34 A T 6: 66,637,515 F80I probably benign Het
Wdr75 G A 1: 45,812,056 S264N probably damaging Het
Zfp652 A T 11: 95,763,790 N340Y probably damaging Het
Zp3 A G 5: 135,987,336 T306A probably benign Het
Other mutations in 1700011I03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:1700011I03Rik APN 18 57594086 missense probably damaging 0.98
IGL01646:1700011I03Rik APN 18 57667345 nonsense probably null
R0115:1700011I03Rik UTSW 18 57594142 splice site probably benign
R0285:1700011I03Rik UTSW 18 57533865 missense probably damaging 0.99
R1087:1700011I03Rik UTSW 18 57730798 missense probably damaging 0.96
R1923:1700011I03Rik UTSW 18 57533887 missense probably damaging 0.99
R4927:1700011I03Rik UTSW 18 57730816 nonsense probably null
R5133:1700011I03Rik UTSW 18 57563969 missense possibly damaging 0.92
R5508:1700011I03Rik UTSW 18 57538084 splice site probably null
R5509:1700011I03Rik UTSW 18 57538084 splice site probably null
R5510:1700011I03Rik UTSW 18 57538084 splice site probably null
R5511:1700011I03Rik UTSW 18 57538084 splice site probably null
R7089:1700011I03Rik UTSW 18 57591987 missense probably benign 0.11
R7545:1700011I03Rik UTSW 18 57730823 missense probably damaging 0.98
R8045:1700011I03Rik UTSW 18 57730919 missense probably damaging 0.99
X0021:1700011I03Rik UTSW 18 57594125 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGATGCAACATCTGGGCC -3'
(R):5'- TAGCCTCATCATTTACAGTGGG -3'

Sequencing Primer
(F):5'- AACATCTGGGCCGTCTCTTGG -3'
(R):5'- CCTCATCATTTACAGTGGGGAGGG -3'
Posted On2018-06-22