Incidental Mutation 'R6598:Tmprss11c'
ID525031
Institutional Source Beutler Lab
Gene Symbol Tmprss11c
Ensembl Gene ENSMUSG00000061184
Gene Nametransmembrane protease, serine 11c
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6598 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location86231481-86289308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86289233 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 10 (E10K)
Ref Sequence ENSEMBL: ENSMUSP00000142902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059424] [ENSMUST00000196462]
Predicted Effect probably benign
Transcript: ENSMUST00000059424
AA Change: E10K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000062915
Gene: ENSMUSG00000061184
AA Change: E10K

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
SEA 58 183 5.19e-3 SMART
Tryp_SPc 199 425 8.42e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196462
AA Change: E10K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000142902
Gene: ENSMUSG00000061184
AA Change: E10K

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
SEA 58 176 3.6e-4 SMART
Tryp_SPc 186 412 4.1e-93 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 A T 14: 55,770,045 S943T probably benign Het
Adgrv1 T G 13: 81,506,179 E2911A probably damaging Het
Ankrd28 A G 14: 31,708,939 F819S probably damaging Het
Cald1 G A 6: 34,746,640 probably null Het
Casc4 A T 2: 121,933,485 E247D probably damaging Het
Casc4 G A 2: 121,933,486 E383K probably damaging Het
Clca2 G T 3: 145,086,485 Y338* probably null Het
Cmya5 C T 13: 93,089,808 G2924D probably benign Het
Col6a4 A T 9: 106,000,412 L2122Q probably damaging Het
Dapk1 T C 13: 60,761,347 F1258S probably benign Het
Ddx39 T C 8: 83,722,927 V387A probably benign Het
Dscam A G 16: 96,819,784 C575R probably damaging Het
Dyrk4 C T 6: 126,876,326 V632M probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ermp1 A G 19: 29,632,502 S111P possibly damaging Het
Fbxo40 A T 16: 36,969,014 L578Q probably damaging Het
Frem1 A T 4: 83,013,828 F212Y probably damaging Het
Icos T G 1: 60,994,697 I162S possibly damaging Het
Kcnj8 G T 6: 142,570,233 N49K probably damaging Het
Ldhb A T 6: 142,490,600 M281K possibly damaging Het
Med17 T C 9: 15,271,700 K350E probably benign Het
Mpo A T 11: 87,799,972 N412I probably benign Het
Mrps24 A T 11: 5,704,713 D80E probably benign Het
Myo5c A G 9: 75,246,234 D134G probably damaging Het
Ndufs1 T C 1: 63,164,950 Q140R probably null Het
Nsd1 T C 13: 55,293,702 V1662A possibly damaging Het
Olfr1115 C T 2: 87,252,756 T273I probably damaging Het
Olfr470 G A 7: 107,845,263 L157F probably benign Het
Olfr794 C A 10: 129,571,369 T238N probably damaging Het
Polq G A 16: 37,061,631 A1386T probably benign Het
Ppil1 C A 17: 29,261,878 V24F probably benign Het
Prim1 G T 10: 128,020,180 V165L possibly damaging Het
Slc12a2 G A 18: 57,898,073 V317I probably benign Het
Tbpl1 A G 10: 22,707,849 V103A probably damaging Het
Unc80 T G 1: 66,468,540 probably null Het
Uqcrc1 G T 9: 108,947,622 V30F possibly damaging Het
Vmn1r88 T C 7: 13,178,223 Y169H probably damaging Het
Zan A T 5: 137,406,364 probably benign Het
Zc3h13 A G 14: 75,332,183 D1490G probably damaging Het
Zer1 T A 2: 30,113,274 S44C probably damaging Het
Zfp106 T A 2: 120,535,060 K289* probably null Het
Zfp618 A G 4: 63,089,399 Y155C probably damaging Het
Zfp979 A G 4: 147,613,766 L162P probably damaging Het
Other mutations in Tmprss11c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Tmprss11c APN 5 86239395 missense probably benign 0.00
IGL01357:Tmprss11c APN 5 86231807 missense probably damaging 1.00
IGL01809:Tmprss11c APN 5 86237662 missense possibly damaging 0.89
IGL02972:Tmprss11c APN 5 86237833 missense possibly damaging 0.77
IGL03135:Tmprss11c APN 5 86237650 missense probably damaging 1.00
IGL03255:Tmprss11c APN 5 86271482 missense probably damaging 0.99
IGL03355:Tmprss11c APN 5 86231871 missense probably benign 0.03
R0165:Tmprss11c UTSW 5 86231927 splice site probably benign
R0285:Tmprss11c UTSW 5 86271430 missense probably damaging 1.00
R0480:Tmprss11c UTSW 5 86237609 splice site probably benign
R0639:Tmprss11c UTSW 5 86235469 missense probably damaging 1.00
R1554:Tmprss11c UTSW 5 86289260 start codon destroyed possibly damaging 0.59
R1651:Tmprss11c UTSW 5 86239424 missense probably damaging 1.00
R2234:Tmprss11c UTSW 5 86282086 missense probably benign 0.12
R2235:Tmprss11c UTSW 5 86282086 missense probably benign 0.12
R2698:Tmprss11c UTSW 5 86271463 missense probably damaging 1.00
R4787:Tmprss11c UTSW 5 86256453 missense probably benign 0.00
R4962:Tmprss11c UTSW 5 86237710 missense probably damaging 1.00
R5063:Tmprss11c UTSW 5 86237830 missense probably benign 0.28
R5217:Tmprss11c UTSW 5 86256390 missense probably benign
R5366:Tmprss11c UTSW 5 86282134 missense possibly damaging 0.93
R6343:Tmprss11c UTSW 5 86256345 missense probably damaging 1.00
R6681:Tmprss11c UTSW 5 86289260 start codon destroyed possibly damaging 0.59
R7170:Tmprss11c UTSW 5 86237619 critical splice donor site probably null
R7198:Tmprss11c UTSW 5 86231832 missense probably damaging 1.00
R7258:Tmprss11c UTSW 5 86271413 missense probably damaging 1.00
R7382:Tmprss11c UTSW 5 86231864 missense probably benign 0.19
R7391:Tmprss11c UTSW 5 86237791 missense probably damaging 1.00
R7590:Tmprss11c UTSW 5 86239473 missense probably benign 0.01
R7894:Tmprss11c UTSW 5 86231796 missense probably damaging 1.00
R8164:Tmprss11c UTSW 5 86231853 missense probably damaging 1.00
R8311:Tmprss11c UTSW 5 86235553 missense probably damaging 1.00
R8416:Tmprss11c UTSW 5 86239417 missense probably damaging 1.00
R8426:Tmprss11c UTSW 5 86231818 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATAGGAGATGAAAGAAACTGCTC -3'
(R):5'- TGGATTGGCATACACACAGCTC -3'

Sequencing Primer
(F):5'- AAAGAAACTGCTCATTTTTAAGAACC -3'
(R):5'- ACACAGCTCCCAGTTTACTAATG -3'
Posted On2018-06-22