Incidental Mutation 'R6598:Kcnj8'
ID525041
Institutional Source Beutler Lab
Gene Symbol Kcnj8
Ensembl Gene ENSMUSG00000030247
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 8
SynonymsKir6.1, sltr, gnite, slmbr
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6598 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location142564837-142571614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 142570233 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 49 (N49K)
Ref Sequence ENSEMBL: ENSMUSP00000145440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032374] [ENSMUST00000203945]
Predicted Effect probably damaging
Transcript: ENSMUST00000032374
AA Change: N49K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032374
Gene: ENSMUSG00000030247
AA Change: N49K

DomainStartEndE-ValueType
Pfam:IRK 37 371 2.3e-141 PFAM
low complexity region 378 404 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203945
AA Change: N49K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145440
Gene: ENSMUSG00000030247
AA Change: N49K

DomainStartEndE-ValueType
Pfam:IRK 37 371 2.3e-141 PFAM
low complexity region 378 404 N/A INTRINSIC
Meta Mutation Damage Score 0.8064 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins. Defects in this gene may be a cause of J-wave syndromes and sudden infant death syndrome (SIDS). [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit sudden cardiac death due to dysregulation of the vascular tonus in the coronary arteries, and exhibit a phenotype resembling Prinzmetal (or variant) angina in humans. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 A T 14: 55,770,045 S943T probably benign Het
Adgrv1 T G 13: 81,506,179 E2911A probably damaging Het
Ankrd28 A G 14: 31,708,939 F819S probably damaging Het
Cald1 G A 6: 34,746,640 probably null Het
Casc4 A T 2: 121,933,485 E247D probably damaging Het
Casc4 G A 2: 121,933,486 E383K probably damaging Het
Clca2 G T 3: 145,086,485 Y338* probably null Het
Cmya5 C T 13: 93,089,808 G2924D probably benign Het
Col6a4 A T 9: 106,000,412 L2122Q probably damaging Het
Dapk1 T C 13: 60,761,347 F1258S probably benign Het
Ddx39 T C 8: 83,722,927 V387A probably benign Het
Dscam A G 16: 96,819,784 C575R probably damaging Het
Dyrk4 C T 6: 126,876,326 V632M probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ermp1 A G 19: 29,632,502 S111P possibly damaging Het
Fbxo40 A T 16: 36,969,014 L578Q probably damaging Het
Frem1 A T 4: 83,013,828 F212Y probably damaging Het
Icos T G 1: 60,994,697 I162S possibly damaging Het
Ldhb A T 6: 142,490,600 M281K possibly damaging Het
Med17 T C 9: 15,271,700 K350E probably benign Het
Mpo A T 11: 87,799,972 N412I probably benign Het
Mrps24 A T 11: 5,704,713 D80E probably benign Het
Myo5c A G 9: 75,246,234 D134G probably damaging Het
Ndufs1 T C 1: 63,164,950 Q140R probably null Het
Nsd1 T C 13: 55,293,702 V1662A possibly damaging Het
Olfr1115 C T 2: 87,252,756 T273I probably damaging Het
Olfr470 G A 7: 107,845,263 L157F probably benign Het
Olfr794 C A 10: 129,571,369 T238N probably damaging Het
Polq G A 16: 37,061,631 A1386T probably benign Het
Ppil1 C A 17: 29,261,878 V24F probably benign Het
Prim1 G T 10: 128,020,180 V165L possibly damaging Het
Slc12a2 G A 18: 57,898,073 V317I probably benign Het
Tbpl1 A G 10: 22,707,849 V103A probably damaging Het
Tmprss11c C T 5: 86,289,233 E10K probably benign Het
Unc80 T G 1: 66,468,540 probably null Het
Uqcrc1 G T 9: 108,947,622 V30F possibly damaging Het
Vmn1r88 T C 7: 13,178,223 Y169H probably damaging Het
Zan A T 5: 137,406,364 probably benign Het
Zc3h13 A G 14: 75,332,183 D1490G probably damaging Het
Zer1 T A 2: 30,113,274 S44C probably damaging Het
Zfp106 T A 2: 120,535,060 K289* probably null Het
Zfp618 A G 4: 63,089,399 Y155C probably damaging Het
Zfp979 A G 4: 147,613,766 L162P probably damaging Het
Other mutations in Kcnj8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Kcnj8 APN 6 142570235 missense probably damaging 1.00
IGL02303:Kcnj8 APN 6 142570111 missense probably benign 0.01
IGL03026:Kcnj8 APN 6 142566473 critical splice acceptor site probably null
goodnight UTSW 6 large deletion
mayday UTSW 6 large deletion
slumber UTSW 6 large deletion
solitaire UTSW 6 large deletion
sos UTSW 6 142565927 missense probably damaging 1.00
R0278:Kcnj8 UTSW 6 142570348 missense probably benign 0.12
R0927:Kcnj8 UTSW 6 142565901 missense possibly damaging 0.82
R1680:Kcnj8 UTSW 6 142570189 nonsense probably null
R1864:Kcnj8 UTSW 6 142570240 missense probably damaging 1.00
R1865:Kcnj8 UTSW 6 142570240 missense probably damaging 1.00
R2087:Kcnj8 UTSW 6 142565696 missense probably benign 0.02
R4900:Kcnj8 UTSW 6 142566495 missense probably damaging 1.00
R5863:Kcnj8 UTSW 6 142565688 missense probably benign 0.02
R6493:Kcnj8 UTSW 6 142566047 missense probably damaging 1.00
R7068:Kcnj8 UTSW 6 142566239 missense probably damaging 1.00
R7587:Kcnj8 UTSW 6 142566339 missense probably damaging 1.00
R7698:Kcnj8 UTSW 6 142565753 missense probably damaging 1.00
R7908:Kcnj8 UTSW 6 142566029 missense probably benign 0.44
R7989:Kcnj8 UTSW 6 142566029 missense probably benign 0.44
X0018:Kcnj8 UTSW 6 142565914 missense probably benign 0.17
X0020:Kcnj8 UTSW 6 142565914 missense probably benign 0.17
X0026:Kcnj8 UTSW 6 142565914 missense probably benign 0.17
X0027:Kcnj8 UTSW 6 142565914 missense probably benign 0.17
X0061:Kcnj8 UTSW 6 142570120 missense probably damaging 1.00
X0065:Kcnj8 UTSW 6 142565914 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CATGTAAGCATAGATGTCCCCG -3'
(R):5'- CGTTTCTCTAGTCTAGGAGGACG -3'

Sequencing Primer
(F):5'- ATAGATGTCCCCGTGGGC -3'
(R):5'- TTCAGGCAGGTGCATAGGC -3'
Posted On2018-06-22