Incidental Mutation 'R6598:Vmn1r88'
ID525043
Institutional Source Beutler Lab
Gene Symbol Vmn1r88
Ensembl Gene ENSMUSG00000095902
Gene Namevomeronasal 1 receptor, 88
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6598 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location13177719-13178669 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13178223 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 169 (Y169H)
Ref Sequence ENSEMBL: ENSMUSP00000128946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171783]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122190
Predicted Effect probably damaging
Transcript: ENSMUST00000171783
AA Change: Y169H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128946
Gene: ENSMUSG00000095902
AA Change: Y169H

DomainStartEndE-ValueType
Pfam:TAS2R 1 306 2e-14 PFAM
Pfam:V1R 35 301 1.4e-30 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 A T 14: 55,770,045 S943T probably benign Het
Adgrv1 T G 13: 81,506,179 E2911A probably damaging Het
Ankrd28 A G 14: 31,708,939 F819S probably damaging Het
Cald1 G A 6: 34,746,640 probably null Het
Casc4 A T 2: 121,933,485 E247D probably damaging Het
Casc4 G A 2: 121,933,486 E383K probably damaging Het
Clca2 G T 3: 145,086,485 Y338* probably null Het
Cmya5 C T 13: 93,089,808 G2924D probably benign Het
Col6a4 A T 9: 106,000,412 L2122Q probably damaging Het
Dapk1 T C 13: 60,761,347 F1258S probably benign Het
Ddx39 T C 8: 83,722,927 V387A probably benign Het
Dscam A G 16: 96,819,784 C575R probably damaging Het
Dyrk4 C T 6: 126,876,326 V632M probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ermp1 A G 19: 29,632,502 S111P possibly damaging Het
Fbxo40 A T 16: 36,969,014 L578Q probably damaging Het
Frem1 A T 4: 83,013,828 F212Y probably damaging Het
Icos T G 1: 60,994,697 I162S possibly damaging Het
Kcnj8 G T 6: 142,570,233 N49K probably damaging Het
Ldhb A T 6: 142,490,600 M281K possibly damaging Het
Med17 T C 9: 15,271,700 K350E probably benign Het
Mpo A T 11: 87,799,972 N412I probably benign Het
Mrps24 A T 11: 5,704,713 D80E probably benign Het
Myo5c A G 9: 75,246,234 D134G probably damaging Het
Ndufs1 T C 1: 63,164,950 Q140R probably null Het
Nsd1 T C 13: 55,293,702 V1662A possibly damaging Het
Olfr1115 C T 2: 87,252,756 T273I probably damaging Het
Olfr470 G A 7: 107,845,263 L157F probably benign Het
Olfr794 C A 10: 129,571,369 T238N probably damaging Het
Polq G A 16: 37,061,631 A1386T probably benign Het
Ppil1 C A 17: 29,261,878 V24F probably benign Het
Prim1 G T 10: 128,020,180 V165L possibly damaging Het
Slc12a2 G A 18: 57,898,073 V317I probably benign Het
Tbpl1 A G 10: 22,707,849 V103A probably damaging Het
Tmprss11c C T 5: 86,289,233 E10K probably benign Het
Unc80 T G 1: 66,468,540 probably null Het
Uqcrc1 G T 9: 108,947,622 V30F possibly damaging Het
Zan A T 5: 137,406,364 probably benign Het
Zc3h13 A G 14: 75,332,183 D1490G probably damaging Het
Zer1 T A 2: 30,113,274 S44C probably damaging Het
Zfp106 T A 2: 120,535,060 K289* probably null Het
Zfp618 A G 4: 63,089,399 Y155C probably damaging Het
Zfp979 A G 4: 147,613,766 L162P probably damaging Het
Other mutations in Vmn1r88
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01828:Vmn1r88 APN 7 13177735 missense probably damaging 1.00
IGL01879:Vmn1r88 APN 7 13178302 missense probably benign 0.12
IGL02028:Vmn1r88 APN 7 13177792 missense probably benign
IGL02586:Vmn1r88 APN 7 13177808 nonsense probably null
IGL03176:Vmn1r88 APN 7 13177852 missense probably damaging 1.00
PIT4466001:Vmn1r88 UTSW 7 13178476 missense possibly damaging 0.83
R1163:Vmn1r88 UTSW 7 13178133 missense probably benign
R1478:Vmn1r88 UTSW 7 13177951 missense probably damaging 1.00
R2376:Vmn1r88 UTSW 7 13177858 missense probably damaging 0.99
R3624:Vmn1r88 UTSW 7 13177863 missense probably benign 0.08
R4543:Vmn1r88 UTSW 7 13177980 missense possibly damaging 0.52
R4593:Vmn1r88 UTSW 7 13177842 missense probably damaging 0.96
R4721:Vmn1r88 UTSW 7 13178524 nonsense probably null
R5927:Vmn1r88 UTSW 7 13178513 missense probably benign 0.12
R6411:Vmn1r88 UTSW 7 13178043 missense probably damaging 1.00
R6535:Vmn1r88 UTSW 7 13178185 missense probably benign 0.03
R6857:Vmn1r88 UTSW 7 13178331 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TCTGTTCTAAGCACATCCCAAG -3'
(R):5'- CTTTGCGCTCAGGAGATGAC -3'

Sequencing Primer
(F):5'- TGTTCTAAGCACATCCCAAGTCATC -3'
(R):5'- CTGGGAGGAAAGGTTTGGGC -3'
Posted On2018-06-22