Incidental Mutation 'R6630:Vmn1r81'
ID525051
Institutional Source Beutler Lab
Gene Symbol Vmn1r81
Ensembl Gene ENSMUSG00000115027
Gene Namevomeronasal 1 receptor 81
SynonymsV1rg9
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.804) question?
Stock #R6630 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location12247241-12268269 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 12260657 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 8 (L8*)
Ref Sequence ENSEMBL: ENSMUSP00000153767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086232] [ENSMUST00000227080] [ENSMUST00000227973] [ENSMUST00000228482] [ENSMUST00000228764]
Predicted Effect probably null
Transcript: ENSMUST00000086232
AA Change: L8*
SMART Domains Protein: ENSMUSP00000083409
Gene: ENSMUSG00000115027
AA Change: L8*

DomainStartEndE-ValueType
Pfam:TAS2R 3 301 5.4e-12 PFAM
Pfam:V1R 34 299 6.6e-31 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000227080
AA Change: L8*
Predicted Effect probably null
Transcript: ENSMUST00000227973
AA Change: L8*
Predicted Effect probably null
Transcript: ENSMUST00000228482
AA Change: L8*
Predicted Effect probably null
Transcript: ENSMUST00000228764
AA Change: L8*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,287,072 M3368K possibly damaging Het
A4gnt A G 9: 99,613,918 T136A probably benign Het
Calb1 T A 4: 15,885,637 D69E probably benign Het
Cecr2 A T 6: 120,762,178 N1261Y probably damaging Het
Cenpo G A 12: 4,217,236 probably benign Het
Cep131 A G 11: 120,073,815 W272R probably damaging Het
Cnr1 T A 4: 33,944,659 I349N probably damaging Het
Dcst1 A T 3: 89,364,326 I50K possibly damaging Het
Dhh C T 15: 98,894,366 V254M possibly damaging Het
Dhrs9 G T 2: 69,397,723 W227L possibly damaging Het
Gm15292 T A 8: 21,249,888 S43T probably damaging Het
Heca G A 10: 17,908,108 R104* probably null Het
Irx4 G T 13: 73,268,426 A314S probably benign Het
Map1s T C 8: 70,913,798 V449A probably damaging Het
Mapk1 A G 16: 17,026,385 D7G probably damaging Het
Mapre3 G T 5: 30,862,542 V56F probably damaging Het
Mepce G A 5: 137,784,921 T381I probably benign Het
Mga T A 2: 119,923,659 V804E probably damaging Het
Myh6 T C 14: 54,942,001 K157E probably benign Het
Olfr393 T A 11: 73,847,876 H83L probably benign Het
Palb2 A T 7: 122,124,529 S303T probably damaging Het
Phc2 C A 4: 128,723,630 P483Q probably damaging Het
Polr2a A G 11: 69,735,513 S1604P possibly damaging Het
Ppp4r3a A G 12: 101,049,776 L39S probably damaging Het
Samsn1 G A 16: 75,879,204 A101V probably benign Het
Tmem2 A G 19: 21,852,229 N1234S probably damaging Het
Trbv3 T A 6: 41,048,572 I32K possibly damaging Het
Trpm3 A T 19: 22,987,983 N1614I probably benign Het
Ubr2 T C 17: 46,951,984 R1234G possibly damaging Het
Usp24 T C 4: 106,387,835 S1291P possibly damaging Het
Vmn2r24 T A 6: 123,787,022 I286N probably benign Het
Other mutations in Vmn1r81
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02026:Vmn1r81 APN 7 12260505 missense probably damaging 1.00
IGL02086:Vmn1r81 APN 7 12259865 missense possibly damaging 0.82
IGL02751:Vmn1r81 APN 7 12260447 missense probably damaging 1.00
IGL02879:Vmn1r81 APN 7 12260392 missense probably benign 0.20
IGL03358:Vmn1r81 APN 7 12260305 missense possibly damaging 0.57
PIT4305001:Vmn1r81 UTSW 7 12260663 missense probably benign 0.01
R0359:Vmn1r81 UTSW 7 12259950 missense probably damaging 1.00
R1615:Vmn1r81 UTSW 7 12260514 missense probably damaging 1.00
R1938:Vmn1r81 UTSW 7 12260662 missense possibly damaging 0.67
R2967:Vmn1r81 UTSW 7 12260037 missense probably damaging 0.99
R2983:Vmn1r81 UTSW 7 12260669 missense probably benign 0.02
R4549:Vmn1r81 UTSW 7 12259822 missense probably damaging 0.99
R5099:Vmn1r81 UTSW 7 12260321 missense possibly damaging 0.86
R5326:Vmn1r81 UTSW 7 12260107 missense probably damaging 1.00
R5542:Vmn1r81 UTSW 7 12260107 missense probably damaging 1.00
R6010:Vmn1r81 UTSW 7 12260422 missense possibly damaging 0.88
R6724:Vmn1r81 UTSW 7 12260672 missense probably damaging 1.00
R6754:Vmn1r81 UTSW 7 12259847 missense probably damaging 0.98
R8198:Vmn1r81 UTSW 7 12259955 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- GCCTTTTGAGATTAGAGACAAGC -3'
(R):5'- CATAGATCTGCCTGCCTCTG -3'

Sequencing Primer
(F):5'- CAGTTGGATAAAGTCAAGTGCTC -3'
(R):5'- CCATTAATGTGTACACCATGACATC -3'
Posted On2018-06-22