Incidental Mutation 'R6598:Uqcrc1'
ID525057
Institutional Source Beutler Lab
Gene Symbol Uqcrc1
Ensembl Gene ENSMUSG00000025651
Gene Nameubiquinol-cytochrome c reductase core protein 1
Synonyms1110032G10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R6598 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location108936633-108949623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 108947622 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 30 (V30F)
Ref Sequence ENSEMBL: ENSMUSP00000141743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026743] [ENSMUST00000194047] [ENSMUST00000194469] [ENSMUST00000195738]
Predicted Effect probably benign
Transcript: ENSMUST00000026743
AA Change: V331F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000026743
Gene: ENSMUSG00000025651
AA Change: V331F

DomainStartEndE-ValueType
low complexity region 17 37 N/A INTRINSIC
Pfam:Peptidase_M16 58 205 2.1e-54 PFAM
Pfam:Peptidase_M16_C 210 395 3.4e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192305
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193607
Predicted Effect probably benign
Transcript: ENSMUST00000194047
SMART Domains Protein: ENSMUSP00000141435
Gene: ENSMUSG00000025651

DomainStartEndE-ValueType
Pfam:Peptidase_M16 41 188 7.7e-53 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000194469
AA Change: V30F

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141743
Gene: ENSMUSG00000025651
AA Change: V30F

DomainStartEndE-ValueType
Pfam:Peptidase_M16_C 1 94 5.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195387
Predicted Effect probably benign
Transcript: ENSMUST00000195738
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 A T 14: 55,770,045 S943T probably benign Het
Adgrv1 T G 13: 81,506,179 E2911A probably damaging Het
Ankrd28 A G 14: 31,708,939 F819S probably damaging Het
Cald1 G A 6: 34,746,640 probably null Het
Casc4 A T 2: 121,933,485 E247D probably damaging Het
Casc4 G A 2: 121,933,486 E383K probably damaging Het
Clca2 G T 3: 145,086,485 Y338* probably null Het
Cmya5 C T 13: 93,089,808 G2924D probably benign Het
Col6a4 A T 9: 106,000,412 L2122Q probably damaging Het
Dapk1 T C 13: 60,761,347 F1258S probably benign Het
Ddx39 T C 8: 83,722,927 V387A probably benign Het
Dscam A G 16: 96,819,784 C575R probably damaging Het
Dyrk4 C T 6: 126,876,326 V632M probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ermp1 A G 19: 29,632,502 S111P possibly damaging Het
Fbxo40 A T 16: 36,969,014 L578Q probably damaging Het
Frem1 A T 4: 83,013,828 F212Y probably damaging Het
Icos T G 1: 60,994,697 I162S possibly damaging Het
Kcnj8 G T 6: 142,570,233 N49K probably damaging Het
Ldhb A T 6: 142,490,600 M281K possibly damaging Het
Med17 T C 9: 15,271,700 K350E probably benign Het
Mpo A T 11: 87,799,972 N412I probably benign Het
Mrps24 A T 11: 5,704,713 D80E probably benign Het
Myo5c A G 9: 75,246,234 D134G probably damaging Het
Ndufs1 T C 1: 63,164,950 Q140R probably null Het
Nsd1 T C 13: 55,293,702 V1662A possibly damaging Het
Olfr1115 C T 2: 87,252,756 T273I probably damaging Het
Olfr470 G A 7: 107,845,263 L157F probably benign Het
Olfr794 C A 10: 129,571,369 T238N probably damaging Het
Polq G A 16: 37,061,631 A1386T probably benign Het
Ppil1 C A 17: 29,261,878 V24F probably benign Het
Prim1 G T 10: 128,020,180 V165L possibly damaging Het
Slc12a2 G A 18: 57,898,073 V317I probably benign Het
Tbpl1 A G 10: 22,707,849 V103A probably damaging Het
Tmprss11c C T 5: 86,289,233 E10K probably benign Het
Unc80 T G 1: 66,468,540 probably null Het
Vmn1r88 T C 7: 13,178,223 Y169H probably damaging Het
Zan A T 5: 137,406,364 probably benign Het
Zc3h13 A G 14: 75,332,183 D1490G probably damaging Het
Zer1 T A 2: 30,113,274 S44C probably damaging Het
Zfp106 T A 2: 120,535,060 K289* probably null Het
Zfp618 A G 4: 63,089,399 Y155C probably damaging Het
Zfp979 A G 4: 147,613,766 L162P probably damaging Het
Other mutations in Uqcrc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Uqcrc1 APN 9 108948958 missense possibly damaging 0.62
IGL02332:Uqcrc1 APN 9 108947869 missense probably damaging 1.00
IGL02698:Uqcrc1 APN 9 108947943 critical splice donor site probably null
R0313:Uqcrc1 UTSW 9 108948574 missense possibly damaging 0.69
R0743:Uqcrc1 UTSW 9 108944705 nonsense probably null
R2027:Uqcrc1 UTSW 9 108947015 missense probably benign 0.06
R2513:Uqcrc1 UTSW 9 108936768 missense probably damaging 1.00
R4680:Uqcrc1 UTSW 9 108947861 missense probably damaging 1.00
R4993:Uqcrc1 UTSW 9 108944810 missense probably damaging 1.00
R5223:Uqcrc1 UTSW 9 108942156 missense probably damaging 1.00
R5716:Uqcrc1 UTSW 9 108947405 missense probably benign
R5941:Uqcrc1 UTSW 9 108947486 unclassified probably benign
R6274:Uqcrc1 UTSW 9 108942156 missense probably damaging 1.00
R7132:Uqcrc1 UTSW 9 108949468 missense probably damaging 0.98
R7150:Uqcrc1 UTSW 9 108947858 missense probably benign 0.02
R7524:Uqcrc1 UTSW 9 108936759 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- CTATGACTGCACTTACGGTGGTG -3'
(R):5'- GCGCATCCTAAAGCAAGTGG -3'

Sequencing Primer
(F):5'- CACTTACGGTGGTGGAGTGGTAAG -3'
(R):5'- TTGAAGTGACGCTCAGTGTCCC -3'
Posted On2018-06-22