Incidental Mutation 'R6598:Olfr794'
ID525063
Institutional Source Beutler Lab
Gene Symbol Olfr794
Ensembl Gene ENSMUSG00000044293
Gene Nameolfactory receptor 794
SynonymsGA_x6K02T2PULF-11248702-11249664, MOR114-11
MMRRC Submission
Accession Numbers

Genbank: NM_146378

Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R6598 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location129567655-129573110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 129571369 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 238 (T238N)
Ref Sequence ENSEMBL: ENSMUSP00000145301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059957] [ENSMUST00000204820]
Predicted Effect probably damaging
Transcript: ENSMUST00000059957
AA Change: T238N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049790
Gene: ENSMUSG00000044293
AA Change: T238N

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.8e-49 PFAM
Pfam:7tm_1 39 288 2e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204820
AA Change: T238N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145301
Gene: ENSMUSG00000044293
AA Change: T238N

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.8e-49 PFAM
Pfam:7tm_1 39 288 2e-22 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 A T 14: 55,770,045 S943T probably benign Het
Adgrv1 T G 13: 81,506,179 E2911A probably damaging Het
Ankrd28 A G 14: 31,708,939 F819S probably damaging Het
Cald1 G A 6: 34,746,640 probably null Het
Casc4 A T 2: 121,933,485 E247D probably damaging Het
Casc4 G A 2: 121,933,486 E383K probably damaging Het
Clca2 G T 3: 145,086,485 Y338* probably null Het
Cmya5 C T 13: 93,089,808 G2924D probably benign Het
Col6a4 A T 9: 106,000,412 L2122Q probably damaging Het
Dapk1 T C 13: 60,761,347 F1258S probably benign Het
Ddx39 T C 8: 83,722,927 V387A probably benign Het
Dscam A G 16: 96,819,784 C575R probably damaging Het
Dyrk4 C T 6: 126,876,326 V632M probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ermp1 A G 19: 29,632,502 S111P possibly damaging Het
Fbxo40 A T 16: 36,969,014 L578Q probably damaging Het
Frem1 A T 4: 83,013,828 F212Y probably damaging Het
Icos T G 1: 60,994,697 I162S possibly damaging Het
Kcnj8 G T 6: 142,570,233 N49K probably damaging Het
Ldhb A T 6: 142,490,600 M281K possibly damaging Het
Med17 T C 9: 15,271,700 K350E probably benign Het
Mpo A T 11: 87,799,972 N412I probably benign Het
Mrps24 A T 11: 5,704,713 D80E probably benign Het
Myo5c A G 9: 75,246,234 D134G probably damaging Het
Ndufs1 T C 1: 63,164,950 Q140R probably null Het
Nsd1 T C 13: 55,293,702 V1662A possibly damaging Het
Olfr1115 C T 2: 87,252,756 T273I probably damaging Het
Olfr470 G A 7: 107,845,263 L157F probably benign Het
Polq G A 16: 37,061,631 A1386T probably benign Het
Ppil1 C A 17: 29,261,878 V24F probably benign Het
Prim1 G T 10: 128,020,180 V165L possibly damaging Het
Slc12a2 G A 18: 57,898,073 V317I probably benign Het
Tbpl1 A G 10: 22,707,849 V103A probably damaging Het
Tmprss11c C T 5: 86,289,233 E10K probably benign Het
Unc80 T G 1: 66,468,540 probably null Het
Uqcrc1 G T 9: 108,947,622 V30F possibly damaging Het
Vmn1r88 T C 7: 13,178,223 Y169H probably damaging Het
Zan A T 5: 137,406,364 probably benign Het
Zc3h13 A G 14: 75,332,183 D1490G probably damaging Het
Zer1 T A 2: 30,113,274 S44C probably damaging Het
Zfp106 T A 2: 120,535,060 K289* probably null Het
Zfp618 A G 4: 63,089,399 Y155C probably damaging Het
Zfp979 A G 4: 147,613,766 L162P probably damaging Het
Other mutations in Olfr794
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01867:Olfr794 APN 10 129570827 missense possibly damaging 0.95
IGL02157:Olfr794 APN 10 129571150 missense probably damaging 1.00
IGL02804:Olfr794 APN 10 129571437 missense possibly damaging 0.60
IGL02833:Olfr794 APN 10 129570750 missense probably benign 0.26
IGL02930:Olfr794 APN 10 129571315 missense probably damaging 1.00
IGL03038:Olfr794 APN 10 129570921 missense probably benign 0.07
G4846:Olfr794 UTSW 10 129571170 missense probably damaging 1.00
R1539:Olfr794 UTSW 10 129570771 missense probably damaging 0.99
R1737:Olfr794 UTSW 10 129570828 missense probably damaging 1.00
R1845:Olfr794 UTSW 10 129571348 missense probably damaging 1.00
R2198:Olfr794 UTSW 10 129571046 nonsense probably null
R3086:Olfr794 UTSW 10 129571407 missense probably damaging 1.00
R4960:Olfr794 UTSW 10 129571026 missense probably damaging 1.00
R5938:Olfr794 UTSW 10 129571527 missense probably damaging 1.00
R6326:Olfr794 UTSW 10 129570702 missense possibly damaging 0.74
R7034:Olfr794 UTSW 10 129571072 missense possibly damaging 0.91
R7066:Olfr794 UTSW 10 129571504 missense probably damaging 1.00
R7226:Olfr794 UTSW 10 129570715 missense probably benign 0.01
R7324:Olfr794 UTSW 10 129570849 missense probably damaging 1.00
R7408:Olfr794 UTSW 10 129570624 start gained probably benign
R7779:Olfr794 UTSW 10 129571311 missense probably damaging 1.00
Z1176:Olfr794 UTSW 10 129571236 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGCATCGCCTCTTATCAAAATCTC -3'
(R):5'- CCAACATGTTCTTATTGGTGTAAGAGG -3'

Sequencing Primer
(F):5'- CAAAATCTCATGCTCAGATACATGG -3'
(R):5'- TCATTAAAAGCTTGTTTCACTTGC -3'
Posted On2018-06-22