Incidental Mutation 'R6630:Myh6'
ID525076
Institutional Source Beutler Lab
Gene Symbol Myh6
Ensembl Gene ENSMUSG00000040752
Gene Namemyosin, heavy polypeptide 6, cardiac muscle, alpha
Synonymsalpha myosin, A830009F23Rik, alpha cardiac MHC, cardiomyopathy, hypertrophic 1, Myhca, Myhc-a, alpha-MHC
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6630 (G1)
Quality Score188.009
Status Not validated
Chromosome14
Chromosomal Location54941921-54966927 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54942001 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 157 (K157E)
Ref Sequence ENSEMBL: ENSMUSP00000153961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037814] [ENSMUST00000081857] [ENSMUST00000226297] [ENSMUST00000227441] [ENSMUST00000228731]
Predicted Effect probably benign
Transcript: ENSMUST00000037814
SMART Domains Protein: ENSMUSP00000036138
Gene: ENSMUSG00000040759

DomainStartEndE-ValueType
transmembrane domain 35 56 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
transmembrane domain 95 114 N/A INTRINSIC
transmembrane domain 119 136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081857
AA Change: K1933E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080538
Gene: ENSMUSG00000040752
AA Change: K1933E

DomainStartEndE-ValueType
Pfam:Myosin_N 34 73 1.9e-15 PFAM
MYSc 79 781 N/A SMART
IQ 782 804 1.15e-1 SMART
IQ 808 830 3.32e2 SMART
Pfam:Myosin_tail_1 845 1926 2.1e-162 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226297
AA Change: K1933E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226807
Predicted Effect probably benign
Transcript: ENSMUST00000227441
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227485
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227905
Predicted Effect probably benign
Transcript: ENSMUST00000228731
AA Change: K157E

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cardiac muscle myosin is a hexamer consisting of two heavy chain subunits, two light chain subunits, and two regulatory subunits. This gene encodes the alpha heavy chain subunit of cardiac myosin. The gene is located approximately 4kb downstream of the gene encoding the beta heavy chain subunit of cardiac myosin. Mutations in this gene cause familial hypertrophic cardiomyopathy and atrial septal defect 3. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality associated with heart defects while heterozygotes show cardiac myofibrillar disarray, cardiac dysfunction and fibrosis. Mice heterozygous for different knock-in alleles may develop hypertrophic or dilated forms of cardiomyopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,287,072 M3368K possibly damaging Het
A4gnt A G 9: 99,613,918 T136A probably benign Het
Calb1 T A 4: 15,885,637 D69E probably benign Het
Cecr2 A T 6: 120,762,178 N1261Y probably damaging Het
Cenpo G A 12: 4,217,236 probably benign Het
Cep131 A G 11: 120,073,815 W272R probably damaging Het
Cnr1 T A 4: 33,944,659 I349N probably damaging Het
Dcst1 A T 3: 89,364,326 I50K possibly damaging Het
Dhh C T 15: 98,894,366 V254M possibly damaging Het
Dhrs9 G T 2: 69,397,723 W227L possibly damaging Het
Gm15292 T A 8: 21,249,888 S43T probably damaging Het
Heca G A 10: 17,908,108 R104* probably null Het
Irx4 G T 13: 73,268,426 A314S probably benign Het
Map1s T C 8: 70,913,798 V449A probably damaging Het
Mapk1 A G 16: 17,026,385 D7G probably damaging Het
Mapre3 G T 5: 30,862,542 V56F probably damaging Het
Mepce G A 5: 137,784,921 T381I probably benign Het
Mga T A 2: 119,923,659 V804E probably damaging Het
Olfr393 T A 11: 73,847,876 H83L probably benign Het
Palb2 A T 7: 122,124,529 S303T probably damaging Het
Phc2 C A 4: 128,723,630 P483Q probably damaging Het
Polr2a A G 11: 69,735,513 S1604P possibly damaging Het
Ppp4r3a A G 12: 101,049,776 L39S probably damaging Het
Samsn1 G A 16: 75,879,204 A101V probably benign Het
Tmem2 A G 19: 21,852,229 N1234S probably damaging Het
Trbv3 T A 6: 41,048,572 I32K possibly damaging Het
Trpm3 A T 19: 22,987,983 N1614I probably benign Het
Ubr2 T C 17: 46,951,984 R1234G possibly damaging Het
Usp24 T C 4: 106,387,835 S1291P possibly damaging Het
Vmn1r81 A T 7: 12,260,657 L8* probably null Het
Vmn2r24 T A 6: 123,787,022 I286N probably benign Het
Other mutations in Myh6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Myh6 APN 14 54946993 missense probably benign 0.13
IGL00401:Myh6 APN 14 54953417 missense probably benign 0.00
IGL01062:Myh6 APN 14 54952292 missense probably damaging 0.99
IGL01300:Myh6 APN 14 54963091 missense possibly damaging 0.94
IGL01688:Myh6 APN 14 54963960 missense possibly damaging 0.74
IGL01695:Myh6 APN 14 54957413 missense probably benign 0.01
IGL01762:Myh6 APN 14 54962081 missense probably benign 0.17
IGL01803:Myh6 APN 14 54944543 missense probably damaging 1.00
IGL02079:Myh6 APN 14 54950541 missense probably damaging 1.00
IGL02315:Myh6 APN 14 54953834 missense probably damaging 1.00
IGL02340:Myh6 APN 14 54957155 missense possibly damaging 0.76
IGL02377:Myh6 APN 14 54944318 missense probably benign 0.10
IGL02715:Myh6 APN 14 54946908 unclassified probably benign
IGL02742:Myh6 APN 14 54953924 missense possibly damaging 0.62
P0028:Myh6 UTSW 14 54963637 missense probably benign
PIT4520001:Myh6 UTSW 14 54950124 missense probably benign 0.00
R0058:Myh6 UTSW 14 54963404 missense probably damaging 1.00
R0090:Myh6 UTSW 14 54958704 missense probably damaging 0.97
R0360:Myh6 UTSW 14 54948347 nonsense probably null
R0364:Myh6 UTSW 14 54948347 nonsense probably null
R0395:Myh6 UTSW 14 54946320 missense possibly damaging 0.94
R0549:Myh6 UTSW 14 54958608 missense probably damaging 1.00
R0559:Myh6 UTSW 14 54958554 missense probably benign
R0800:Myh6 UTSW 14 54953278 splice site probably benign
R0892:Myh6 UTSW 14 54947054 missense probably benign 0.17
R0975:Myh6 UTSW 14 54953369 missense probably damaging 1.00
R1051:Myh6 UTSW 14 54949527 missense probably benign 0.12
R1180:Myh6 UTSW 14 54944468 missense possibly damaging 0.93
R1311:Myh6 UTSW 14 54946365 missense probably damaging 0.96
R1490:Myh6 UTSW 14 54962718 nonsense probably null
R1531:Myh6 UTSW 14 54956506 missense probably damaging 1.00
R1835:Myh6 UTSW 14 54957401 missense probably benign 0.03
R1845:Myh6 UTSW 14 54944674 missense probably damaging 1.00
R2033:Myh6 UTSW 14 54963645 missense probably benign 0.00
R2143:Myh6 UTSW 14 54952954 missense probably damaging 1.00
R2146:Myh6 UTSW 14 54953771 missense probably damaging 1.00
R2155:Myh6 UTSW 14 54953794 missense probably benign
R2484:Myh6 UTSW 14 54961242 nonsense probably null
R3155:Myh6 UTSW 14 54944668 missense probably damaging 0.97
R3156:Myh6 UTSW 14 54944668 missense probably damaging 0.97
R3780:Myh6 UTSW 14 54963958 missense probably benign 0.00
R3906:Myh6 UTSW 14 54956955 missense probably benign 0.04
R3937:Myh6 UTSW 14 54963055 missense probably benign 0.00
R3938:Myh6 UTSW 14 54963055 missense probably benign 0.00
R4236:Myh6 UTSW 14 54960362 missense probably benign 0.15
R4373:Myh6 UTSW 14 54962108 missense probably damaging 0.97
R4374:Myh6 UTSW 14 54962108 missense probably damaging 0.97
R4377:Myh6 UTSW 14 54962108 missense probably damaging 0.97
R4798:Myh6 UTSW 14 54953293 missense probably damaging 1.00
R4844:Myh6 UTSW 14 54947194 missense possibly damaging 0.89
R4908:Myh6 UTSW 14 54956962 missense probably damaging 1.00
R5256:Myh6 UTSW 14 54952661 missense probably damaging 1.00
R5277:Myh6 UTSW 14 54956562 missense probably benign 0.01
R5356:Myh6 UTSW 14 54953762 missense probably damaging 1.00
R5433:Myh6 UTSW 14 54953924 missense probably benign 0.32
R5616:Myh6 UTSW 14 54956581 missense probably benign 0.17
R5784:Myh6 UTSW 14 54953064 missense possibly damaging 0.93
R5820:Myh6 UTSW 14 54958680 missense probably damaging 0.99
R5835:Myh6 UTSW 14 54950407 missense probably damaging 1.00
R5922:Myh6 UTSW 14 54946474 missense probably damaging 0.99
R5975:Myh6 UTSW 14 54950508 missense probably benign 0.31
R5988:Myh6 UTSW 14 54965394 missense probably damaging 1.00
R6845:Myh6 UTSW 14 54944749 missense probably benign
R7009:Myh6 UTSW 14 54952292 missense probably damaging 0.99
R7154:Myh6 UTSW 14 54960307 missense probably benign 0.43
R7293:Myh6 UTSW 14 54947174 missense probably benign 0.00
R7313:Myh6 UTSW 14 54960270 missense probably benign 0.00
R7339:Myh6 UTSW 14 54961568 intron probably null
R7348:Myh6 UTSW 14 54952259 missense probably damaging 1.00
R7487:Myh6 UTSW 14 54953496 nonsense probably null
R7680:Myh6 UTSW 14 54948733 missense possibly damaging 0.88
R7726:Myh6 UTSW 14 54965365 missense probably damaging 0.99
R7743:Myh6 UTSW 14 54957150 missense probably damaging 0.99
R7807:Myh6 UTSW 14 54942440 missense probably damaging 1.00
Z1088:Myh6 UTSW 14 54956997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGGGTGCTTCAGATCTTACAG -3'
(R):5'- CTGTAACCTGAGAGTCCACTC -3'

Sequencing Primer
(F):5'- TCAGATCTTACAGCTCTGACAG -3'
(R):5'- TTGAAGTGGGCCCCAGATCTG -3'
Posted On2018-06-22