Incidental Mutation 'R6630:Samsn1'
ID525082
Institutional Source Beutler Lab
Gene Symbol Samsn1
Ensembl Gene ENSMUSG00000022876
Gene NameSAM domain, SH3 domain and nuclear localization signals, 1
Synonyms4930571B16Rik, Hacs1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6630 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location75858793-76022281 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 75879204 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 101 (A101V)
Ref Sequence ENSEMBL: ENSMUSP00000109877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114239] [ENSMUST00000114240]
PDB Structure
Solution structure of the Sterile Alpha Motif (SAM) domain of mouse SAMSN1 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000114239
AA Change: A101V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000109877
Gene: ENSMUSG00000022876
AA Change: A101V

DomainStartEndE-ValueType
Pfam:SLY 17 164 4.7e-57 PFAM
SH3 166 223 8.78e-4 SMART
SAM 238 305 7.6e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114240
SMART Domains Protein: ENSMUSP00000109878
Gene: ENSMUSG00000022876

DomainStartEndE-ValueType
low complexity region 69 80 N/A INTRINSIC
Pfam:SLY 146 293 1.1e-55 PFAM
SH3 295 352 8.78e-4 SMART
SAM 367 434 7.6e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226794
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SAMSN1 is a member of a novel gene family of putative adaptors and scaffold proteins containing SH3 and SAM (sterile alpha motif) domains (Claudio et al., 2001 [PubMed 11536050]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced adaptive immunity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,287,072 M3368K possibly damaging Het
A4gnt A G 9: 99,613,918 T136A probably benign Het
Calb1 T A 4: 15,885,637 D69E probably benign Het
Cecr2 A T 6: 120,762,178 N1261Y probably damaging Het
Cenpo G A 12: 4,217,236 probably benign Het
Cep131 A G 11: 120,073,815 W272R probably damaging Het
Cnr1 T A 4: 33,944,659 I349N probably damaging Het
Dcst1 A T 3: 89,364,326 I50K possibly damaging Het
Dhh C T 15: 98,894,366 V254M possibly damaging Het
Dhrs9 G T 2: 69,397,723 W227L possibly damaging Het
Gm15292 T A 8: 21,249,888 S43T probably damaging Het
Heca G A 10: 17,908,108 R104* probably null Het
Irx4 G T 13: 73,268,426 A314S probably benign Het
Map1s T C 8: 70,913,798 V449A probably damaging Het
Mapk1 A G 16: 17,026,385 D7G probably damaging Het
Mapre3 G T 5: 30,862,542 V56F probably damaging Het
Mepce G A 5: 137,784,921 T381I probably benign Het
Mga T A 2: 119,923,659 V804E probably damaging Het
Myh6 T C 14: 54,942,001 K157E probably benign Het
Olfr393 T A 11: 73,847,876 H83L probably benign Het
Palb2 A T 7: 122,124,529 S303T probably damaging Het
Phc2 C A 4: 128,723,630 P483Q probably damaging Het
Polr2a A G 11: 69,735,513 S1604P possibly damaging Het
Ppp4r3a A G 12: 101,049,776 L39S probably damaging Het
Tmem2 A G 19: 21,852,229 N1234S probably damaging Het
Trbv3 T A 6: 41,048,572 I32K possibly damaging Het
Trpm3 A T 19: 22,987,983 N1614I probably benign Het
Ubr2 T C 17: 46,951,984 R1234G possibly damaging Het
Usp24 T C 4: 106,387,835 S1291P possibly damaging Het
Vmn1r81 A T 7: 12,260,657 L8* probably null Het
Vmn2r24 T A 6: 123,787,022 I286N probably benign Het
Other mutations in Samsn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Samsn1 APN 16 75909120 splice site probably benign
IGL02220:Samsn1 APN 16 75883875 critical splice donor site probably null
R0455:Samsn1 UTSW 16 75945225 unclassified noncoding transcript
R1136:Samsn1 UTSW 16 75873520 missense probably null 0.00
R1140:Samsn1 UTSW 16 75888742 missense possibly damaging 0.73
R1180:Samsn1 UTSW 16 75873648 missense probably damaging 1.00
R1772:Samsn1 UTSW 16 75870775 missense probably benign 0.01
R1968:Samsn1 UTSW 16 75945573 exon noncoding transcript
R4035:Samsn1 UTSW 16 75909185 start codon destroyed probably null 0.99
R4372:Samsn1 UTSW 16 75859456 missense possibly damaging 0.80
R4725:Samsn1 UTSW 16 75945329 unclassified noncoding transcript
R4779:Samsn1 UTSW 16 75947289 exon noncoding transcript
R4795:Samsn1 UTSW 16 75883845 intron probably benign
R4899:Samsn1 UTSW 16 75879103 missense probably damaging 1.00
R4905:Samsn1 UTSW 16 75876465 missense possibly damaging 0.94
R5050:Samsn1 UTSW 16 75888757 missense probably benign
R5789:Samsn1 UTSW 16 75876448 missense probably damaging 1.00
R6005:Samsn1 UTSW 16 75873514 missense probably benign 0.03
R6190:Samsn1 UTSW 16 75870915 missense probably damaging 1.00
R6218:Samsn1 UTSW 16 75945274 unclassified noncoding transcript
R7086:Samsn1 UTSW 16 75870906 missense probably benign 0.00
R8289:Samsn1 UTSW 16 75888796 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTTTGAACTAGCTTATCCCAGGC -3'
(R):5'- CCACAATAAGTAATGTCTCATCTAGGG -3'

Sequencing Primer
(F):5'- GAACTAGCTTATCCCAGGCTCCATG -3'
(R):5'- GGAATTTTCCCAAGTATCCTCTAAC -3'
Posted On2018-06-22