Incidental Mutation 'R6599:Zfp979'
ID525105
Institutional Source Beutler Lab
Gene Symbol Zfp979
Ensembl Gene ENSMUSG00000066000
Gene Namezinc finger protein 979
Synonyms2610305D13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R6599 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location147611937-147642513 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 147613626 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 209 (C209S)
Ref Sequence ENSEMBL: ENSMUSP00000101345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037565] [ENSMUST00000105720] [ENSMUST00000133006]
Predicted Effect probably benign
Transcript: ENSMUST00000037565
AA Change: C209S

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000038153
Gene: ENSMUSG00000066000
AA Change: C209S

DomainStartEndE-ValueType
KRAB 28 88 2.06e-16 SMART
ZnF_C2H2 257 279 2.06e1 SMART
ZnF_C2H2 285 307 2.53e-2 SMART
ZnF_C2H2 313 335 1.95e-3 SMART
ZnF_C2H2 341 363 1.4e1 SMART
ZnF_C2H2 369 391 9.08e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105720
AA Change: C209S

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101345
Gene: ENSMUSG00000066000
AA Change: C209S

DomainStartEndE-ValueType
KRAB 28 88 2.06e-16 SMART
ZnF_C2H2 257 279 2.06e1 SMART
ZnF_C2H2 285 307 2.53e-2 SMART
ZnF_C2H2 313 335 1.95e-3 SMART
ZnF_C2H2 341 363 1.4e1 SMART
ZnF_C2H2 369 391 9.08e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133006
SMART Domains Protein: ENSMUSP00000114677
Gene: ENSMUSG00000066000

DomainStartEndE-ValueType
KRAB 28 88 2.06e-16 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 94% (32/34)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,176,489 H150R probably benign Het
Acbd5 C T 2: 23,069,080 probably benign Het
Adcyap1r1 G A 6: 55,479,994 V237M probably damaging Het
Akr1c6 T G 13: 4,449,319 probably null Het
BC037034 G T 5: 138,263,458 probably null Het
Ccdc7b T A 8: 129,166,981 F96L probably benign Het
Cubn T C 2: 13,310,673 H2983R possibly damaging Het
Dhx40 T A 11: 86,804,349 I112L possibly damaging Het
Dnmbp A T 19: 43,856,586 D1070E probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ep300 G C 15: 81,586,713 D29H unknown Het
Exoc3 T C 13: 74,189,158 probably null Het
Fuk A T 8: 110,893,283 probably null Het
Gm6401 C A 14: 41,966,864 E83* probably null Het
Gm8267 G T 14: 44,717,910 T218K possibly damaging Het
Hif3a T A 7: 17,042,605 D470V possibly damaging Het
Hist1h1d T C 13: 23,555,277 probably null Het
Igf2r T C 17: 12,698,618 S1526G possibly damaging Het
Lrp2 T C 2: 69,469,405 D3101G probably damaging Het
Megf6 A G 4: 154,258,087 probably null Het
Mthfs G A 9: 89,239,908 G149D probably damaging Het
Nnmt T C 9: 48,603,369 D116G probably benign Het
Nqo2 T C 13: 33,979,556 F22S probably damaging Het
Olfr389 T A 11: 73,776,680 M216L probably benign Het
Olfr869 T C 9: 20,137,943 S276P probably damaging Het
Parm1 T C 5: 91,593,859 S29P possibly damaging Het
Prokr2 C T 2: 132,373,549 V331M possibly damaging Het
Ptch1 T A 13: 63,523,104 I871F probably damaging Het
Rps6ka5 C A 12: 100,597,909 G227V probably damaging Het
Tcaim C T 9: 122,834,779 Q445* probably null Het
Trpc7 T C 13: 56,810,380 probably null Het
Ubxn7 A G 16: 32,384,925 E465G probably damaging Het
Unk G A 11: 116,047,802 R77Q probably damaging Het
Vmn1r226 A T 17: 20,688,289 N261I probably benign Het
Vmn1r87 T A 7: 13,131,959 K134* probably null Het
Vmn2r10 T A 5: 108,996,078 I669L probably benign Het
Vmn2r115 A G 17: 23,346,032 I298V probably benign Het
Yipf2 T C 9: 21,589,848 K85E probably damaging Het
Other mutations in Zfp979
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Zfp979 APN 4 147615396 missense probably damaging 0.98
IGL01865:Zfp979 APN 4 147615317 missense probably benign 0.03
IGL02336:Zfp979 APN 4 147615351 missense probably damaging 1.00
R0336:Zfp979 UTSW 4 147613135 missense possibly damaging 0.86
R1365:Zfp979 UTSW 4 147613224 missense probably benign 0.00
R1440:Zfp979 UTSW 4 147614036 missense possibly damaging 0.96
R1714:Zfp979 UTSW 4 147613985 missense probably damaging 1.00
R1796:Zfp979 UTSW 4 147613283 missense probably damaging 0.99
R2155:Zfp979 UTSW 4 147613458 missense possibly damaging 0.86
R3735:Zfp979 UTSW 4 147613482 missense possibly damaging 0.93
R3963:Zfp979 UTSW 4 147613131 missense probably benign 0.34
R3972:Zfp979 UTSW 4 147618419 nonsense probably null
R4471:Zfp979 UTSW 4 147613456 nonsense probably null
R4983:Zfp979 UTSW 4 147613914 missense possibly damaging 0.94
R5310:Zfp979 UTSW 4 147613918 missense possibly damaging 0.95
R5805:Zfp979 UTSW 4 147613610 missense probably damaging 0.99
R5861:Zfp979 UTSW 4 147613509 nonsense probably null
R6598:Zfp979 UTSW 4 147613766 missense probably damaging 0.99
R6925:Zfp979 UTSW 4 147613542 missense possibly damaging 0.86
R7684:Zfp979 UTSW 4 147613342 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTGTATGAATTCTCTGATGCATAC -3'
(R):5'- TCGGACCACTAAAGAAGTTTGC -3'

Sequencing Primer
(F):5'- ctgatggataccaagatagaact -3'
(R):5'- AGACTGTGTAAACCGTTTAAAGGTG -3'
Posted On2018-06-22