Mutagenetix > Incidental Mutations

Incidental Mutation 'R6631:Prdm2'

525108

Institutional Source

Beutler Lab

Gene Symbol

Prdm2

Ensembl Gene

ENSMUSG00000057637

Gene Name

PR domain containing 2, with ZNF domain

Synonyms

KMT8, LOC381568, E330024L24Rik, Riz1, Riz, 4833427P12Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6631 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

143107391-143212995 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 143134884 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Proline at position 612 (Q612P)

Ref Sequence

ENSEMBL: ENSMUSP00000101404 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105778]

Predicted Effect

probably benign
Transcript: ENSMUST00000105778
AA Change: Q612P

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000101404
Gene: ENSMUSG00000057637
AA Change: Q612P

Domain	Start	End	E-Value	Type
SET	29	146	2.79e-21	SMART
coiled coil region	254	293	N/A	INTRINSIC
low complexity region	333	346	N/A	INTRINSIC
ZnF_C2H2	356	378	2.95e-3	SMART
ZnF_C2H2	386	408	4.79e-3	SMART
ZnF_C2H2	477	500	4.17e-3	SMART
low complexity region	517	528	N/A	INTRINSIC
low complexity region	653	669	N/A	INTRINSIC
low complexity region	682	697	N/A	INTRINSIC
low complexity region	726	744	N/A	INTRINSIC
low complexity region	868	877	N/A	INTRINSIC
low complexity region	931	951	N/A	INTRINSIC
low complexity region	954	992	N/A	INTRINSIC
low complexity region	1011	1032	N/A	INTRINSIC
low complexity region	1035	1080	N/A	INTRINSIC
ZnF_C2H2	1126	1148	3.52e-1	SMART
ZnF_C2H2	1154	1177	7.55e-1	SMART
ZnF_C2H2	1183	1206	4.72e-2	SMART
low complexity region	1239	1253	N/A	INTRINSIC
ZnF_C2H2	1324	1344	5.12e1	SMART
low complexity region	1406	1423	N/A	INTRINSIC
ZnF_C2H2	1446	1466	1.86e1	SMART
low complexity region	1475	1507	N/A	INTRINSIC
low complexity region	1551	1568	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197026

Meta Mutation Damage Score

0.1476

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 93.9%

Validation Efficiency

96% (50/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This tumor suppressor gene is a member of a nuclear histone/protein methyltransferase superfamily. It encodes a zinc finger protein that can bind to retinoblastoma protein, estrogen receptor, and the TPA-responsive element (MTE) of the heme-oxygenase-1 gene. Although the functions of this protein have not been fully characterized, it may (1) play a role in transcriptional regulation during neuronal differentiation and pathogenesis of retinoblastoma, (2) act as a transcriptional activator of the heme-oxygenase-1 gene, and (3) be a specific effector of estrogen action. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mice have shortened life spans, becoming moribund due to increased incidence of tumors. Mice had a broad spectrum of unusual tumors in multiple organs, with a high incidence of diffuse large B cell lymphomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406C07Rik	A	T	9: 15,292,030	N159K	probably damaging	Het
Arhgef10l	T	C	4: 140,517,747		probably benign	Het
Avil	A	G	10: 127,007,749	S153G	possibly damaging	Het
C2cd3	G	A	7: 100,418,540	D877N	probably damaging	Het
Clca3a2	G	A	3: 144,813,644	A257V	probably benign	Het
Cramp1l	T	A	17: 24,983,957	H366L	probably benign	Het
Cyp2c37	C	T	19: 40,009,843	S393L	probably damaging	Het
Defb8	T	A	8: 19,445,934	I37L	probably benign	Het
Dennd4b	C	A	3: 90,277,732		probably null	Het
Eps8l2	G	A	7: 141,356,202	R223H	probably damaging	Het
Erbin	A	G	13: 103,824,892	L1302P	probably benign	Het
Exoc3l	A	G	8: 105,295,361	W37R	probably damaging	Het
Fam214a	A	G	9: 74,953,825	D4G	possibly damaging	Het
Fap	T	C	2: 62,503,381	N668S	probably damaging	Het
Gas7	A	G	11: 67,674,281	N250S	probably damaging	Het
Hist1h2bk	T	A	13: 22,036,221	V112E	probably damaging	Het
Hivep1	C	A	13: 42,156,480	P732Q	probably damaging	Het
Irx4	G	T	13: 73,268,426	A314S	probably benign	Het
Itgb8	A	T	12: 119,180,977	L332*	probably null	Het
Kctd19	A	G	8: 105,385,328		probably null	Het
Kif14	G	A	1: 136,515,959	S1290N	probably benign	Het
Klk1b3	C	T	7: 44,201,464	T140I	probably benign	Het
Lama1	A	G	17: 67,774,482	N1305D	probably benign	Het
Lrp1	A	T	10: 127,574,332	V1515E	probably damaging	Het
Man2b1	A	G	8: 85,086,811		probably null	Het
Mocos	A	G	18: 24,699,931	T818A	probably benign	Het
Mpc2	G	T	1: 165,479,512	W94L	probably benign	Het
Mrc1	G	A	2: 14,238,485	V141I	probably benign	Het
Nalcn	T	C	14: 123,460,251	T538A	probably benign	Het
Ndufs3	G	A	2: 90,902,400	T114M	probably damaging	Het
Noct	T	C	3: 51,250,200	C320R	probably damaging	Het
Olfr1472	T	A	19: 13,453,821	Q232L	probably benign	Het
Pcdha11	G	T	18: 37,005,791	A158S	probably damaging	Het
Pcdhga8	T	A	18: 37,727,056	D388E	probably benign	Het
Peg3	T	C	7: 6,709,070	E1051G	possibly damaging	Het
Phlda2	T	A	7: 143,502,181	I104F	probably damaging	Het
Polr2a	A	G	11: 69,735,513	S1604P	possibly damaging	Het
Pomt2	C	T	12: 87,139,643		probably null	Het
Ppp6r2	G	A	15: 89,253,255		probably null	Het
Prr5	C	A	15: 84,702,777	R243S	probably damaging	Het
Ptgdr2	T	C	19: 10,940,869	I250T	probably benign	Het
Rad54l2	A	T	9: 106,713,540	C462*	probably null	Het
Sec16a	T	A	2: 26,439,957	E682V	probably damaging	Het
Serpina3i	A	G	12: 104,266,466	D210G	probably damaging	Het
Slain2	T	A	5: 72,957,405	D326E	probably benign	Het
Sned1	A	G	1: 93,281,652	E829G	probably damaging	Het
Steap4	G	A	5: 7,976,995	W319*	probably null	Het
Taar8c	A	G	10: 24,101,803	V37A	probably benign	Het
Tdrd12	T	A	7: 35,485,229	Y753F	probably damaging	Het
Tnxb	A	G	17: 34,718,248	S3770G	probably damaging	Het
Trrap	A	G	5: 144,771,650	N48S	possibly damaging	Het
Zfp558	C	A	9: 18,456,923	G190*	probably null	Het

Other mutations in Prdm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00530:Prdm2	APN	4	143133759	missense	probably damaging	0.99
IGL00843:Prdm2	APN	4	143134314	missense	probably damaging	1.00
IGL01419:Prdm2	APN	4	143133648	missense	probably damaging	0.99
IGL01662:Prdm2	APN	4	143133568	missense	possibly damaging	0.73
IGL01892:Prdm2	APN	4	143134404	missense	probably damaging	1.00
IGL02104:Prdm2	APN	4	143133427	missense	probably benign	0.01
IGL02208:Prdm2	APN	4	143135743	missense	probably benign	0.01
IGL02260:Prdm2	APN	4	143134587	missense	probably damaging	1.00
IGL02479:Prdm2	APN	4	143134929	missense	probably damaging	1.00
IGL02943:Prdm2	APN	4	143131972	missense	probably benign
IGL02972:Prdm2	APN	4	143132166	missense	probably benign
IGL03038:Prdm2	APN	4	143134001	missense	probably damaging	1.00
IGL03399:Prdm2	APN	4	143135088	missense	probably benign	0.07
PIT4677001:Prdm2	UTSW	4	143135078	missense	probably damaging	1.00
R0088:Prdm2	UTSW	4	143134954	missense	possibly damaging	0.86
R0153:Prdm2	UTSW	4	143133768	missense	possibly damaging	0.93
R0320:Prdm2	UTSW	4	143179351	missense	probably damaging	1.00
R0384:Prdm2	UTSW	4	143135688	missense	probably benign	0.01
R0400:Prdm2	UTSW	4	143111670	missense	probably benign
R0658:Prdm2	UTSW	4	143135265	missense	probably damaging	1.00
R0850:Prdm2	UTSW	4	143132203	missense	possibly damaging	0.53
R1118:Prdm2	UTSW	4	143132383	missense	possibly damaging	0.52
R1355:Prdm2	UTSW	4	143131963	missense	probably benign	0.33
R1519:Prdm2	UTSW	4	143135583	missense	probably damaging	1.00
R1936:Prdm2	UTSW	4	143134462	missense	probably benign	0.00
R1987:Prdm2	UTSW	4	143132509	missense	possibly damaging	0.73
R2006:Prdm2	UTSW	4	143131877	missense	possibly damaging	0.73
R2008:Prdm2	UTSW	4	143134947	missense	probably damaging	1.00
R2030:Prdm2	UTSW	4	143132764	missense	possibly damaging	0.53
R2112:Prdm2	UTSW	4	143131936	missense	probably benign
R2221:Prdm2	UTSW	4	143134899	missense	possibly damaging	0.58
R2223:Prdm2	UTSW	4	143134899	missense	possibly damaging	0.58
R2426:Prdm2	UTSW	4	143111750	nonsense	probably null
R2430:Prdm2	UTSW	4	143133163	missense	possibly damaging	0.73
R2484:Prdm2	UTSW	4	143135206	missense	probably damaging	1.00
R3735:Prdm2	UTSW	4	143134359	missense	probably damaging	1.00
R3944:Prdm2	UTSW	4	143131815	missense	possibly damaging	0.53
R4209:Prdm2	UTSW	4	143134437	missense	probably damaging	1.00
R4411:Prdm2	UTSW	4	143133670	missense	probably benign	0.18
R4647:Prdm2	UTSW	4	143132955	missense	possibly damaging	0.85
R4898:Prdm2	UTSW	4	143134191	missense	probably damaging	1.00
R5032:Prdm2	UTSW	4	143179367	nonsense	probably null
R5181:Prdm2	UTSW	4	143134966	missense	probably benign	0.35
R5513:Prdm2	UTSW	4	143135893	small deletion	probably benign
R5539:Prdm2	UTSW	4	143132694	missense	possibly damaging	0.53
R5563:Prdm2	UTSW	4	143134630	missense	probably benign	0.09
R5618:Prdm2	UTSW	4	143133537	missense	probably benign	0.00
R5900:Prdm2	UTSW	4	143134720	missense	probably damaging	1.00
R5990:Prdm2	UTSW	4	143170113	missense	probably damaging	1.00
R6148:Prdm2	UTSW	4	143132907	missense	probably benign	0.33
R6166:Prdm2	UTSW	4	143134736	missense	probably damaging	0.99
R6223:Prdm2	UTSW	4	143142207	missense	probably benign	0.41
R6530:Prdm2	UTSW	4	143134047	missense	probably benign	0.05
R6725:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
R6847:Prdm2	UTSW	4	143132950	missense	probably benign	0.18
R7193:Prdm2	UTSW	4	143180894	missense	probably damaging	1.00
R7238:Prdm2	UTSW	4	143135821	missense	probably benign	0.35
R7292:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
R7417:Prdm2	UTSW	4	143179299	missense	probably damaging	1.00
R7748:Prdm2	UTSW	4	143135889	missense	possibly damaging	0.89
R7885:Prdm2	UTSW	4	143134570	missense	probably benign	0.41
R7936:Prdm2	UTSW	4	143135864	missense	probably damaging	0.99
R7976:Prdm2	UTSW	4	143133242	nonsense	probably null
R8124:Prdm2	UTSW	4	143135265	missense	probably damaging	1.00
R8150:Prdm2	UTSW	4	143132733	missense	possibly damaging	0.73
R8156:Prdm2	UTSW	4	143134768	missense	probably benign	0.01
R8178:Prdm2	UTSW	4	143132448	missense	probably benign	0.33
R8235:Prdm2	UTSW	4	143132467	nonsense	probably null
R8404:Prdm2	UTSW	4	143135014	missense	probably damaging	0.98
R8498:Prdm2	UTSW	4	143180897	missense	probably damaging	1.00
R8502:Prdm2	UTSW	4	143135014	missense	probably damaging	0.98
X0017:Prdm2	UTSW	4	143134707	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGTTGATATGCTCAGAGGCAG -3'
(R):5'- TGTCTATGTACCAAGCACAGAG -3'

Sequencing Primer
(F):5'- TTGATATGCTCAGAGGCAGACTTAAG -3'
(R):5'- CGCAGATGATGTGTATATCATGGAC -3'

Posted On

2018-06-22