Mutagenetix > Incidental Mutations

Incidental Mutation 'R6631:C2cd3'

525122

Institutional Source

Beutler Lab

Gene Symbol

C2cd3

Ensembl Gene

ENSMUSG00000047248

Gene Name

C2 calcium-dependent domain containing 3

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6631 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

100372233-100470152 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 100418540 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 877 (D877N)

Ref Sequence

ENSEMBL: ENSMUSP00000095859 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051777] [ENSMUST00000098259] [ENSMUST00000133464]

Predicted Effect

probably damaging
Transcript: ENSMUST00000051777
AA Change: D877N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000062637
Gene: ENSMUSG00000047248
AA Change: D877N

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	406	417	N/A	INTRINSIC
C2	524	662	2.36e1	SMART
C2	790	899	3.73e0	SMART
C2	989	1129	1.47e1	SMART
C2	1182	1321	1.63e1	SMART
C2	1617	1724	1.43e-2	SMART
low complexity region	1892	1906	N/A	INTRINSIC
low complexity region	2037	2049	N/A	INTRINSIC
low complexity region	2110	2125	N/A	INTRINSIC
low complexity region	2180	2197	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000098259
AA Change: D877N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095859
Gene: ENSMUSG00000047248
AA Change: D877N

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	406	417	N/A	INTRINSIC
C2	524	662	2.36e1	SMART
C2	790	899	3.73e0	SMART
C2	989	1129	1.47e1	SMART
C2	1182	1321	1.63e1	SMART
C2	1617	1724	1.43e-2	SMART
low complexity region	1892	1906	N/A	INTRINSIC
low complexity region	2037	2049	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000119647
AA Change: D499N

SMART Domains

Protein: ENSMUSP00000113360
Gene: ENSMUSG00000047248
AA Change: D499N

Domain	Start	End	E-Value	Type
C2	61	199	2.36e1	SMART
C2	327	436	3.73e0	SMART
C2	526	666	1.47e1	SMART
C2	719	858	1.63e1	SMART
C2	1154	1261	1.43e-2	SMART
low complexity region	1429	1443	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000133464

SMART Domains

Protein: ENSMUSP00000118864
Gene: ENSMUSG00000047248

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184753

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208753

Meta Mutation Damage Score

0.3109

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 93.9%

Validation Efficiency

96% (50/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a regulator of centriole elongation. Studies of the orthologous mouse protein show that it promotes centriolar distal appendage assembly and is also required for the recruitment of other ciliogenic proteins, including intraflagellar transport proteins. Mutations in this gene cause orofaciodigital syndrome XIV (OFD14), a ciliopathy resulting in malformations of the oral cavity, face and digits. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes inactivating allele are embryonic lethal with pericardial edema and twisted body axis, abnormal patterning of brain and open neural tube defect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406C07Rik	A	T	9: 15,292,030	N159K	probably damaging	Het
Arhgef10l	T	C	4: 140,517,747		probably benign	Het
Avil	A	G	10: 127,007,749	S153G	possibly damaging	Het
Clca3a2	G	A	3: 144,813,644	A257V	probably benign	Het
Cramp1l	T	A	17: 24,983,957	H366L	probably benign	Het
Cyp2c37	C	T	19: 40,009,843	S393L	probably damaging	Het
Defb8	T	A	8: 19,445,934	I37L	probably benign	Het
Dennd4b	C	A	3: 90,277,732		probably null	Het
Eps8l2	G	A	7: 141,356,202	R223H	probably damaging	Het
Erbin	A	G	13: 103,824,892	L1302P	probably benign	Het
Exoc3l	A	G	8: 105,295,361	W37R	probably damaging	Het
Fam214a	A	G	9: 74,953,825	D4G	possibly damaging	Het
Fap	T	C	2: 62,503,381	N668S	probably damaging	Het
Gas7	A	G	11: 67,674,281	N250S	probably damaging	Het
Hist1h2bk	T	A	13: 22,036,221	V112E	probably damaging	Het
Hivep1	C	A	13: 42,156,480	P732Q	probably damaging	Het
Irx4	G	T	13: 73,268,426	A314S	probably benign	Het
Itgb8	A	T	12: 119,180,977	L332*	probably null	Het
Kctd19	A	G	8: 105,385,328		probably null	Het
Kif14	G	A	1: 136,515,959	S1290N	probably benign	Het
Klk1b3	C	T	7: 44,201,464	T140I	probably benign	Het
Lama1	A	G	17: 67,774,482	N1305D	probably benign	Het
Lrp1	A	T	10: 127,574,332	V1515E	probably damaging	Het
Man2b1	A	G	8: 85,086,811		probably null	Het
Mocos	A	G	18: 24,699,931	T818A	probably benign	Het
Mpc2	G	T	1: 165,479,512	W94L	probably benign	Het
Mrc1	G	A	2: 14,238,485	V141I	probably benign	Het
Nalcn	T	C	14: 123,460,251	T538A	probably benign	Het
Ndufs3	G	A	2: 90,902,400	T114M	probably damaging	Het
Noct	T	C	3: 51,250,200	C320R	probably damaging	Het
Olfr1472	T	A	19: 13,453,821	Q232L	probably benign	Het
Pcdha11	G	T	18: 37,005,791	A158S	probably damaging	Het
Pcdhga8	T	A	18: 37,727,056	D388E	probably benign	Het
Peg3	T	C	7: 6,709,070	E1051G	possibly damaging	Het
Phlda2	T	A	7: 143,502,181	I104F	probably damaging	Het
Polr2a	A	G	11: 69,735,513	S1604P	possibly damaging	Het
Pomt2	C	T	12: 87,139,643		probably null	Het
Ppp6r2	G	A	15: 89,253,255		probably null	Het
Prdm2	T	G	4: 143,134,884	Q612P	probably benign	Het
Prr5	C	A	15: 84,702,777	R243S	probably damaging	Het
Ptgdr2	T	C	19: 10,940,869	I250T	probably benign	Het
Rad54l2	A	T	9: 106,713,540	C462*	probably null	Het
Sec16a	T	A	2: 26,439,957	E682V	probably damaging	Het
Serpina3i	A	G	12: 104,266,466	D210G	probably damaging	Het
Slain2	T	A	5: 72,957,405	D326E	probably benign	Het
Sned1	A	G	1: 93,281,652	E829G	probably damaging	Het
Steap4	G	A	5: 7,976,995	W319*	probably null	Het
Taar8c	A	G	10: 24,101,803	V37A	probably benign	Het
Tdrd12	T	A	7: 35,485,229	Y753F	probably damaging	Het
Tnxb	A	G	17: 34,718,248	S3770G	probably damaging	Het
Trrap	A	G	5: 144,771,650	N48S	possibly damaging	Het
Zfp558	C	A	9: 18,456,923	G190*	probably null	Het

Other mutations in C2cd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00540:C2cd3	APN	7	100391128	missense	probably benign	0.14
IGL01420:C2cd3	APN	7	100454858	missense	probably benign	0.35
IGL01775:C2cd3	APN	7	100443431	missense	probably damaging	1.00
IGL01832:C2cd3	APN	7	100427214	missense	possibly damaging	0.94
IGL01883:C2cd3	APN	7	100374486	missense	possibly damaging	0.80
IGL02664:C2cd3	APN	7	100419715	missense	possibly damaging	0.67
IGL02697:C2cd3	APN	7	100427169	unclassified	probably benign
IGL02852:C2cd3	APN	7	100430189	missense	probably damaging	1.00
IGL03158:C2cd3	APN	7	100374476	missense	probably damaging	1.00
R0012:C2cd3	UTSW	7	100418522	missense	possibly damaging	0.52
R0012:C2cd3	UTSW	7	100418522	missense	possibly damaging	0.52
R0013:C2cd3	UTSW	7	100416062	missense	probably damaging	1.00
R0013:C2cd3	UTSW	7	100416062	missense	probably damaging	1.00
R0032:C2cd3	UTSW	7	100444445	unclassified	probably benign
R0032:C2cd3	UTSW	7	100444445	unclassified	probably benign
R0124:C2cd3	UTSW	7	100469518	missense	probably benign
R0387:C2cd3	UTSW	7	100422507	splice site	probably benign
R0522:C2cd3	UTSW	7	100395222	missense	probably benign	0.14
R1124:C2cd3	UTSW	7	100422681	missense	probably benign	0.00
R1484:C2cd3	UTSW	7	100440190	missense	probably damaging	1.00
R1533:C2cd3	UTSW	7	100406077	missense	possibly damaging	0.54
R1631:C2cd3	UTSW	7	100372497	critical splice donor site	probably null
R1875:C2cd3	UTSW	7	100407025	missense	possibly damaging	0.89
R2059:C2cd3	UTSW	7	100455493	unclassified	probably benign
R2060:C2cd3	UTSW	7	100454948	missense	probably damaging	1.00
R2348:C2cd3	UTSW	7	100413366	missense	probably damaging	1.00
R3103:C2cd3	UTSW	7	100395252	missense	possibly damaging	0.47
R3405:C2cd3	UTSW	7	100390166	missense	probably benign	0.01
R3687:C2cd3	UTSW	7	100435833	missense	probably benign	0.28
R3775:C2cd3	UTSW	7	100431998	missense	probably damaging	1.00
R3854:C2cd3	UTSW	7	100454601	critical splice acceptor site	probably null
R4359:C2cd3	UTSW	7	100441089	missense	probably damaging	1.00
R4403:C2cd3	UTSW	7	100432099	missense	probably damaging	1.00
R4446:C2cd3	UTSW	7	100374477	missense	probably damaging	1.00
R4646:C2cd3	UTSW	7	100372450	unclassified	probably benign
R4705:C2cd3	UTSW	7	100395188	missense	possibly damaging	0.77
R4770:C2cd3	UTSW	7	100443435	missense	probably damaging	1.00
R4777:C2cd3	UTSW	7	100416332	missense	possibly damaging	0.46
R4816:C2cd3	UTSW	7	100391019	missense	probably benign	0.01
R4842:C2cd3	UTSW	7	100416190	missense	probably benign	0.00
R4858:C2cd3	UTSW	7	100454953	missense	probably damaging	1.00
R4871:C2cd3	UTSW	7	100413374	missense	possibly damaging	0.79
R4898:C2cd3	UTSW	7	100405959	missense	probably damaging	1.00
R5026:C2cd3	UTSW	7	100459842	missense	possibly damaging	0.52
R5112:C2cd3	UTSW	7	100443485	missense	possibly damaging	0.91
R5242:C2cd3	UTSW	7	100390166	missense	probably benign	0.01
R5538:C2cd3	UTSW	7	100455493	critical splice donor site	probably null
R5861:C2cd3	UTSW	7	100444475	unclassified	probably benign
R6110:C2cd3	UTSW	7	100441076	missense	probably damaging	1.00
R6326:C2cd3	UTSW	7	100416428	missense	probably benign	0.02
R6429:C2cd3	UTSW	7	100432091	missense	probably damaging	1.00
R6610:C2cd3	UTSW	7	100455298	missense	probably benign
R6613:C2cd3	UTSW	7	100395241	missense	possibly damaging	0.87
R6787:C2cd3	UTSW	7	100455346	missense	probably benign
R6837:C2cd3	UTSW	7	100448746	missense	probably damaging	1.00
R6849:C2cd3	UTSW	7	100406927	missense	probably damaging	1.00
R6860:C2cd3	UTSW	7	100390241	missense	probably benign	0.28
R6929:C2cd3	UTSW	7	100451619	missense	probably damaging	1.00
R7026:C2cd3	UTSW	7	100432092	missense	probably damaging	1.00
R7088:C2cd3	UTSW	7	100416181	missense
R7174:C2cd3	UTSW	7	100432198	missense
R7241:C2cd3	UTSW	7	100407050	missense
R7335:C2cd3	UTSW	7	100422603	missense
R7357:C2cd3	UTSW	7	100430103	missense
R7493:C2cd3	UTSW	7	100427226	missense
R7567:C2cd3	UTSW	7	100430815	missense
R7573:C2cd3	UTSW	7	100419707	missense
R7869:C2cd3	UTSW	7	100469491	missense	probably damaging	0.99
R7999:C2cd3	UTSW	7	100459889	critical splice donor site	probably null
R8134:C2cd3	UTSW	7	100418504	missense
R8369:C2cd3	UTSW	7	100395258	missense	probably benign	0.03
R8372:C2cd3	UTSW	7	100455280	nonsense	probably null
X0002:C2cd3	UTSW	7	100440235	missense	possibly damaging	0.50

Predicted Primers

PCR Primer
(F):5'- TTAGAGAGAACCCATGCTGGC -3'
(R):5'- ACTGAGAAAGGCTCTTTGCG -3'

Sequencing Primer
(F):5'- AGAGAACCCATGCTGGCTTGTATC -3'
(R):5'- GGGATTCTACTCATGCTGGCATATC -3'

Posted On

2018-06-22