Incidental Mutation 'R6631:Phlda2'
ID525126
Institutional Source Beutler Lab
Gene Symbol Phlda2
Ensembl Gene ENSMUSG00000010760
Gene Namepleckstrin homology like domain, family A, member 2
SynonymsTssc3, Ipl
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6631 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location143501545-143503150 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 143502181 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 104 (I104F)
Ref Sequence ENSEMBL: ENSMUSP00000010904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010904] [ENSMUST00000052348] [ENSMUST00000105917] [ENSMUST00000145943] [ENSMUST00000207425]
Predicted Effect probably damaging
Transcript: ENSMUST00000010904
AA Change: I104F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000010904
Gene: ENSMUSG00000010760
AA Change: I104F

DomainStartEndE-ValueType
PH 18 111 1.54e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052348
SMART Domains Protein: ENSMUSP00000056082
Gene: ENSMUSG00000000154

DomainStartEndE-ValueType
Pfam:MFS_1 14 339 1.1e-31 PFAM
Pfam:MFS_1 229 410 5.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105917
SMART Domains Protein: ENSMUSP00000101537
Gene: ENSMUSG00000000154

DomainStartEndE-ValueType
Pfam:MFS_1 14 337 7.8e-32 PFAM
Pfam:MFS_3 66 346 6.5e-9 PFAM
Pfam:MFS_1 229 410 3.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145943
SMART Domains Protein: ENSMUSP00000115345
Gene: ENSMUSG00000000154

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207425
AA Change: I104F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207561
Meta Mutation Damage Score 0.5507 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: This gene is one of several genes in the imprinted gene domain on chromosome 7. Studies using knockout mice have shown that the product of this gene regulates placental growth. Transcripts from this gene are most abundant in placenta and yolk sac, and are almost entirely transcribed from the maternal allele. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene have enlarged placentas but display little change in fetal weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik A T 9: 15,292,030 N159K probably damaging Het
Arhgef10l T C 4: 140,517,747 probably benign Het
Avil A G 10: 127,007,749 S153G possibly damaging Het
C2cd3 G A 7: 100,418,540 D877N probably damaging Het
Clca3a2 G A 3: 144,813,644 A257V probably benign Het
Cramp1l T A 17: 24,983,957 H366L probably benign Het
Cyp2c37 C T 19: 40,009,843 S393L probably damaging Het
Defb8 T A 8: 19,445,934 I37L probably benign Het
Dennd4b C A 3: 90,277,732 probably null Het
Eps8l2 G A 7: 141,356,202 R223H probably damaging Het
Erbin A G 13: 103,824,892 L1302P probably benign Het
Exoc3l A G 8: 105,295,361 W37R probably damaging Het
Fam214a A G 9: 74,953,825 D4G possibly damaging Het
Fap T C 2: 62,503,381 N668S probably damaging Het
Gas7 A G 11: 67,674,281 N250S probably damaging Het
Hist1h2bk T A 13: 22,036,221 V112E probably damaging Het
Hivep1 C A 13: 42,156,480 P732Q probably damaging Het
Irx4 G T 13: 73,268,426 A314S probably benign Het
Itgb8 A T 12: 119,180,977 L332* probably null Het
Kctd19 A G 8: 105,385,328 probably null Het
Kif14 G A 1: 136,515,959 S1290N probably benign Het
Klk1b3 C T 7: 44,201,464 T140I probably benign Het
Lama1 A G 17: 67,774,482 N1305D probably benign Het
Lrp1 A T 10: 127,574,332 V1515E probably damaging Het
Man2b1 A G 8: 85,086,811 probably null Het
Mocos A G 18: 24,699,931 T818A probably benign Het
Mpc2 G T 1: 165,479,512 W94L probably benign Het
Mrc1 G A 2: 14,238,485 V141I probably benign Het
Nalcn T C 14: 123,460,251 T538A probably benign Het
Ndufs3 G A 2: 90,902,400 T114M probably damaging Het
Noct T C 3: 51,250,200 C320R probably damaging Het
Olfr1472 T A 19: 13,453,821 Q232L probably benign Het
Pcdha11 G T 18: 37,005,791 A158S probably damaging Het
Pcdhga8 T A 18: 37,727,056 D388E probably benign Het
Peg3 T C 7: 6,709,070 E1051G possibly damaging Het
Polr2a A G 11: 69,735,513 S1604P possibly damaging Het
Pomt2 C T 12: 87,139,643 probably null Het
Ppp6r2 G A 15: 89,253,255 probably null Het
Prdm2 T G 4: 143,134,884 Q612P probably benign Het
Prr5 C A 15: 84,702,777 R243S probably damaging Het
Ptgdr2 T C 19: 10,940,869 I250T probably benign Het
Rad54l2 A T 9: 106,713,540 C462* probably null Het
Sec16a T A 2: 26,439,957 E682V probably damaging Het
Serpina3i A G 12: 104,266,466 D210G probably damaging Het
Slain2 T A 5: 72,957,405 D326E probably benign Het
Sned1 A G 1: 93,281,652 E829G probably damaging Het
Steap4 G A 5: 7,976,995 W319* probably null Het
Taar8c A G 10: 24,101,803 V37A probably benign Het
Tdrd12 T A 7: 35,485,229 Y753F probably damaging Het
Tnxb A G 17: 34,718,248 S3770G probably damaging Het
Trrap A G 5: 144,771,650 N48S possibly damaging Het
Zfp558 C A 9: 18,456,923 G190* probably null Het
Other mutations in Phlda2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Phlda2 APN 7 143502139 unclassified probably null
R4965:Phlda2 UTSW 7 143502268 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATCGAAGTTTTCCCCACTGG -3'
(R):5'- ACCTCCGACGAGATCCTTTG -3'

Sequencing Primer
(F):5'- GAGGCATGACCCCCATTC -3'
(R):5'- AAGCGACAGCCTGTTCCAG -3'
Posted On2018-06-22