Incidental Mutation 'R6599:Unk'
ID525137
Institutional Source Beutler Lab
Gene Symbol Unk
Ensembl Gene ENSMUSG00000020770
Gene Nameunkempt family zinc finger
SynonymsZc3h5, B230379M23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.814) question?
Stock #R6599 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location116030322-116061214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 116047802 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 77 (R77Q)
Ref Sequence ENSEMBL: ENSMUSP00000102060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021116] [ENSMUST00000106452]
Predicted Effect probably damaging
Transcript: ENSMUST00000021116
AA Change: R77Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021116
Gene: ENSMUSG00000020770
AA Change: R77Q

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 70 78 N/A INTRINSIC
ZnF_C3H1 85 112 1.03e-2 SMART
ZnF_C3H1 124 153 4.3e1 SMART
ZnF_C3H1 215 240 1.1e0 SMART
ZnF_C3H1 251 284 2.17e-1 SMART
ZnF_C3H1 293 320 1.38e-3 SMART
low complexity region 347 365 N/A INTRINSIC
low complexity region 467 489 N/A INTRINSIC
low complexity region 563 585 N/A INTRINSIC
coiled coil region 643 723 N/A INTRINSIC
RING 769 800 2.74e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106452
AA Change: R77Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102060
Gene: ENSMUSG00000020770
AA Change: R77Q

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 70 78 N/A INTRINSIC
ZnF_C3H1 85 112 1.03e-2 SMART
ZnF_C3H1 124 153 4.3e1 SMART
ZnF_C3H1 215 240 1.1e0 SMART
ZnF_C3H1 251 284 2.17e-1 SMART
ZnF_C3H1 293 320 1.38e-3 SMART
low complexity region 454 476 N/A INTRINSIC
low complexity region 550 572 N/A INTRINSIC
coiled coil region 630 710 N/A INTRINSIC
RING 756 787 2.74e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150759
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176212
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 94% (32/34)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,176,489 H150R probably benign Het
Acbd5 C T 2: 23,069,080 probably benign Het
Adcyap1r1 G A 6: 55,479,994 V237M probably damaging Het
Akr1c6 T G 13: 4,449,319 probably null Het
BC037034 G T 5: 138,263,458 probably null Het
Ccdc7b T A 8: 129,166,981 F96L probably benign Het
Cubn T C 2: 13,310,673 H2983R possibly damaging Het
Dhx40 T A 11: 86,804,349 I112L possibly damaging Het
Dnmbp A T 19: 43,856,586 D1070E probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ep300 G C 15: 81,586,713 D29H unknown Het
Exoc3 T C 13: 74,189,158 probably null Het
Fuk A T 8: 110,893,283 probably null Het
Gm6401 C A 14: 41,966,864 E83* probably null Het
Gm8267 G T 14: 44,717,910 T218K possibly damaging Het
Hif3a T A 7: 17,042,605 D470V possibly damaging Het
Hist1h1d T C 13: 23,555,277 probably null Het
Igf2r T C 17: 12,698,618 S1526G possibly damaging Het
Lrp2 T C 2: 69,469,405 D3101G probably damaging Het
Megf6 A G 4: 154,258,087 probably null Het
Mthfs G A 9: 89,239,908 G149D probably damaging Het
Nnmt T C 9: 48,603,369 D116G probably benign Het
Nqo2 T C 13: 33,979,556 F22S probably damaging Het
Olfr389 T A 11: 73,776,680 M216L probably benign Het
Olfr869 T C 9: 20,137,943 S276P probably damaging Het
Parm1 T C 5: 91,593,859 S29P possibly damaging Het
Prokr2 C T 2: 132,373,549 V331M possibly damaging Het
Ptch1 T A 13: 63,523,104 I871F probably damaging Het
Rps6ka5 C A 12: 100,597,909 G227V probably damaging Het
Tcaim C T 9: 122,834,779 Q445* probably null Het
Trpc7 T C 13: 56,810,380 probably null Het
Ubxn7 A G 16: 32,384,925 E465G probably damaging Het
Vmn1r226 A T 17: 20,688,289 N261I probably benign Het
Vmn1r87 T A 7: 13,131,959 K134* probably null Het
Vmn2r10 T A 5: 108,996,078 I669L probably benign Het
Vmn2r115 A G 17: 23,346,032 I298V probably benign Het
Yipf2 T C 9: 21,589,848 K85E probably damaging Het
Zfp979 A T 4: 147,613,626 C209S probably benign Het
Other mutations in Unk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01782:Unk APN 11 116058379 missense probably benign 0.44
IGL01956:Unk APN 11 116056334 missense probably damaging 1.00
IGL02044:Unk APN 11 116049328 missense probably damaging 0.99
IGL02738:Unk APN 11 116056191 missense probably damaging 1.00
IGL02861:Unk APN 11 116056299 missense possibly damaging 0.58
legal_midget UTSW 11 116050724 missense probably damaging 1.00
produce UTSW 11 116051459 missense probably damaging 1.00
R0098:Unk UTSW 11 116050169 missense probably damaging 1.00
R0098:Unk UTSW 11 116050169 missense probably damaging 1.00
R0827:Unk UTSW 11 116053109 missense possibly damaging 0.59
R1471:Unk UTSW 11 116049409 missense probably benign 0.45
R1824:Unk UTSW 11 116030442 unclassified probably benign
R1900:Unk UTSW 11 116059081 missense probably benign 0.01
R3052:Unk UTSW 11 116050123 missense probably benign 0.01
R4033:Unk UTSW 11 116053527 missense probably benign 0.00
R4449:Unk UTSW 11 116053634 missense probably damaging 1.00
R4593:Unk UTSW 11 116049056 missense probably benign 0.02
R4847:Unk UTSW 11 116054406 missense probably damaging 1.00
R4921:Unk UTSW 11 116054945 missense probably benign
R4940:Unk UTSW 11 116053665 missense possibly damaging 0.63
R5099:Unk UTSW 11 116059110 missense probably benign 0.00
R5838:Unk UTSW 11 116049331 missense probably damaging 1.00
R6351:Unk UTSW 11 116054946 missense probably benign
R6387:Unk UTSW 11 116054940 missense possibly damaging 0.88
R6551:Unk UTSW 11 116050724 missense probably damaging 1.00
R6554:Unk UTSW 11 116051459 missense probably damaging 1.00
R6733:Unk UTSW 11 116050755 missense probably damaging 1.00
R7743:Unk UTSW 11 116049436 missense possibly damaging 0.74
R7765:Unk UTSW 11 116053082 missense probably benign 0.25
Z1176:Unk UTSW 11 116047764 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTAAAATCCGAGGTCCAGCC -3'
(R):5'- AGCAGCCTCAGCCTAAATG -3'

Sequencing Primer
(F):5'- CTCTTGCTGTCCCAGTGGG -3'
(R):5'- TAAATGTCCCACACTTATCCTGAGGG -3'
Posted On2018-06-22