Incidental Mutation 'R6599:Hist1h1d'
ID525143
Institutional Source Beutler Lab
Gene Symbol Hist1h1d
Ensembl Gene ENSMUSG00000052565
Gene Namehistone cluster 1, H1d
SynonymsH1s-4, H1.3, H1D, H1f3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6599 (G1)
Quality Score199.009
Status Validated
Chromosome13
Chromosomal Location23553262-23560686 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 23555277 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000100036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045301] [ENSMUST00000102971]
Predicted Effect probably damaging
Transcript: ENSMUST00000045301
AA Change: L63P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044395
Gene: ENSMUSG00000052565
AA Change: L63P

DomainStartEndE-ValueType
H15 35 100 4.02e-23 SMART
low complexity region 110 221 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102971
SMART Domains Protein: ENSMUSP00000100036
Gene: ENSMUSG00000069274

DomainStartEndE-ValueType
H4 16 90 2.59e-29 SMART
Meta Mutation Damage Score 0.9358 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 94% (32/34)
MGI Phenotype FUNCTION: Histones are basic nuclear proteins responsible for nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H1 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations are phenotypically normal. However, Hist1h1c/Hist1h1e/Hist1h1d triple knockout mice die by embryonic day 12.5, and heterozygotes are underrepresented. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,176,489 H150R probably benign Het
Acbd5 C T 2: 23,069,080 probably benign Het
Adcyap1r1 G A 6: 55,479,994 V237M probably damaging Het
Akr1c6 T G 13: 4,449,319 probably null Het
BC037034 G T 5: 138,263,458 probably null Het
Ccdc7b T A 8: 129,166,981 F96L probably benign Het
Cubn T C 2: 13,310,673 H2983R possibly damaging Het
Dhx40 T A 11: 86,804,349 I112L possibly damaging Het
Dnmbp A T 19: 43,856,586 D1070E probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ep300 G C 15: 81,586,713 D29H unknown Het
Exoc3 T C 13: 74,189,158 probably null Het
Fuk A T 8: 110,893,283 probably null Het
Gm6401 C A 14: 41,966,864 E83* probably null Het
Gm8267 G T 14: 44,717,910 T218K possibly damaging Het
Hif3a T A 7: 17,042,605 D470V possibly damaging Het
Igf2r T C 17: 12,698,618 S1526G possibly damaging Het
Lrp2 T C 2: 69,469,405 D3101G probably damaging Het
Megf6 A G 4: 154,258,087 probably null Het
Mthfs G A 9: 89,239,908 G149D probably damaging Het
Nnmt T C 9: 48,603,369 D116G probably benign Het
Nqo2 T C 13: 33,979,556 F22S probably damaging Het
Olfr389 T A 11: 73,776,680 M216L probably benign Het
Olfr869 T C 9: 20,137,943 S276P probably damaging Het
Parm1 T C 5: 91,593,859 S29P possibly damaging Het
Prokr2 C T 2: 132,373,549 V331M possibly damaging Het
Ptch1 T A 13: 63,523,104 I871F probably damaging Het
Rps6ka5 C A 12: 100,597,909 G227V probably damaging Het
Tcaim C T 9: 122,834,779 Q445* probably null Het
Trpc7 T C 13: 56,810,380 probably null Het
Ubxn7 A G 16: 32,384,925 E465G probably damaging Het
Unk G A 11: 116,047,802 R77Q probably damaging Het
Vmn1r226 A T 17: 20,688,289 N261I probably benign Het
Vmn1r87 T A 7: 13,131,959 K134* probably null Het
Vmn2r10 T A 5: 108,996,078 I669L probably benign Het
Vmn2r115 A G 17: 23,346,032 I298V probably benign Het
Yipf2 T C 9: 21,589,848 K85E probably damaging Het
Zfp979 A T 4: 147,613,626 C209S probably benign Het
Other mutations in Hist1h1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
Tease UTSW 13 23555277 unclassified probably null
R0485:Hist1h1d UTSW 13 23555750 nonsense probably null
R1954:Hist1h1d UTSW 13 23555516 unclassified probably benign
R4773:Hist1h1d UTSW 13 23555402 missense probably damaging 1.00
R7800:Hist1h1d UTSW 13 23555367 missense possibly damaging 0.93
R7818:Hist1h1d UTSW 13 23554991 unclassified probably benign
R7902:Hist1h1d UTSW 13 23555331 missense probably damaging 0.96
X0065:Hist1h1d UTSW 13 23555147 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AAGCTTAGAACATGTCCGAGAC -3'
(R):5'- AGCACCAGTCGCCTTCTTAG -3'

Sequencing Primer
(F):5'- TTAGAACATGTCCGAGACCGCTC -3'
(R):5'- GCTTCTTGGCCTTGGCCG -3'
Posted On2018-06-22