Incidental Mutation 'R6631:Taar8c'
ID525144
Institutional Source Beutler Lab
Gene Symbol Taar8c
Ensembl Gene ENSMUSG00000100004
Gene Nametrace amine-associated receptor 8C
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R6631 (G1)
Quality Score174.009
Status Not validated
Chromosome10
Chromosomal Location24100878-24101912 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24101803 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 37 (V37A)
Ref Sequence ENSEMBL: ENSMUSP00000133193 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170267]
Predicted Effect probably benign
Transcript: ENSMUST00000170267
AA Change: V37A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000133193
Gene: ENSMUSG00000100004
AA Change: V37A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 40 244 2.7e-8 PFAM
Pfam:7TM_GPCR_Srsx 42 327 4.9e-15 PFAM
Pfam:7tm_1 48 312 2.3e-57 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 96% (50/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik A T 9: 15,292,030 N159K probably damaging Het
Arhgef10l T C 4: 140,517,747 probably benign Het
Avil A G 10: 127,007,749 S153G possibly damaging Het
C2cd3 G A 7: 100,418,540 D877N probably damaging Het
Clca3a2 G A 3: 144,813,644 A257V probably benign Het
Cramp1l T A 17: 24,983,957 H366L probably benign Het
Cyp2c37 C T 19: 40,009,843 S393L probably damaging Het
Defb8 T A 8: 19,445,934 I37L probably benign Het
Dennd4b C A 3: 90,277,732 probably null Het
Eps8l2 G A 7: 141,356,202 R223H probably damaging Het
Erbin A G 13: 103,824,892 L1302P probably benign Het
Exoc3l A G 8: 105,295,361 W37R probably damaging Het
Fam214a A G 9: 74,953,825 D4G possibly damaging Het
Fap T C 2: 62,503,381 N668S probably damaging Het
Gas7 A G 11: 67,674,281 N250S probably damaging Het
Hist1h2bk T A 13: 22,036,221 V112E probably damaging Het
Hivep1 C A 13: 42,156,480 P732Q probably damaging Het
Irx4 G T 13: 73,268,426 A314S probably benign Het
Itgb8 A T 12: 119,180,977 L332* probably null Het
Kctd19 A G 8: 105,385,328 probably null Het
Kif14 G A 1: 136,515,959 S1290N probably benign Het
Klk1b3 C T 7: 44,201,464 T140I probably benign Het
Lama1 A G 17: 67,774,482 N1305D probably benign Het
Lrp1 A T 10: 127,574,332 V1515E probably damaging Het
Man2b1 A G 8: 85,086,811 probably null Het
Mocos A G 18: 24,699,931 T818A probably benign Het
Mpc2 G T 1: 165,479,512 W94L probably benign Het
Mrc1 G A 2: 14,238,485 V141I probably benign Het
Nalcn T C 14: 123,460,251 T538A probably benign Het
Ndufs3 G A 2: 90,902,400 T114M probably damaging Het
Noct T C 3: 51,250,200 C320R probably damaging Het
Olfr1472 T A 19: 13,453,821 Q232L probably benign Het
Pcdha11 G T 18: 37,005,791 A158S probably damaging Het
Pcdhga8 T A 18: 37,727,056 D388E probably benign Het
Peg3 T C 7: 6,709,070 E1051G possibly damaging Het
Phlda2 T A 7: 143,502,181 I104F probably damaging Het
Polr2a A G 11: 69,735,513 S1604P possibly damaging Het
Pomt2 C T 12: 87,139,643 probably null Het
Ppp6r2 G A 15: 89,253,255 probably null Het
Prdm2 T G 4: 143,134,884 Q612P probably benign Het
Prr5 C A 15: 84,702,777 R243S probably damaging Het
Ptgdr2 T C 19: 10,940,869 I250T probably benign Het
Rad54l2 A T 9: 106,713,540 C462* probably null Het
Sec16a T A 2: 26,439,957 E682V probably damaging Het
Serpina3i A G 12: 104,266,466 D210G probably damaging Het
Slain2 T A 5: 72,957,405 D326E probably benign Het
Sned1 A G 1: 93,281,652 E829G probably damaging Het
Steap4 G A 5: 7,976,995 W319* probably null Het
Tdrd12 T A 7: 35,485,229 Y753F probably damaging Het
Tnxb A G 17: 34,718,248 S3770G probably damaging Het
Trrap A G 5: 144,771,650 N48S possibly damaging Het
Zfp558 C A 9: 18,456,923 G190* probably null Het
Other mutations in Taar8c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Taar8c APN 10 24101275 missense probably damaging 0.99
IGL01733:Taar8c APN 10 24101257 missense possibly damaging 0.86
R0669:Taar8c UTSW 10 24101503 missense probably damaging 1.00
R1186:Taar8c UTSW 10 24101565 nonsense probably null
R1452:Taar8c UTSW 10 24101610 missense probably benign 0.00
R2256:Taar8c UTSW 10 24101071 missense probably benign 0.01
R4364:Taar8c UTSW 10 24101579 missense probably benign 0.02
R4904:Taar8c UTSW 10 24101249 missense probably benign 0.01
R5314:Taar8c UTSW 10 24101348 missense probably damaging 1.00
R6163:Taar8c UTSW 10 24101218 missense probably benign 0.00
R7428:Taar8c UTSW 10 24101548 missense probably damaging 1.00
R7497:Taar8c UTSW 10 24101218 missense probably benign 0.00
R7525:Taar8c UTSW 10 24101866 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGCTCTCAATGGACCTGACC -3'
(R):5'- CCTGGGATTAACAGTGATGTTTAAC -3'

Sequencing Primer
(F):5'- TGGACCTGACCATGCTGAAG -3'
(R):5'- TTCTTCAGTATGGAGTTCATT -3'
Posted On2018-06-22