Incidental Mutation 'R6599:Nqo2'
List |< first << previous [record 23 of 39] next >> last >|
ID525145
Institutional Source Beutler Lab
Gene Symbol Nqo2
Ensembl Gene ENSMUSG00000046949
Gene NameN-ribosyldihydronicotinamide quinone reductase 2
SynonymsNmor2, Ox-2, NRH: quinone oxidoreductase, Ox2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R6599 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location33964687-33988443 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33979556 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 22 (F22S)
Ref Sequence ENSEMBL: ENSMUSP00000152068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021843] [ENSMUST00000058978] [ENSMUST00000076532] [ENSMUST00000166354] [ENSMUST00000167237] [ENSMUST00000168400] [ENSMUST00000171034] [ENSMUST00000220844] [ENSMUST00000222740] [ENSMUST00000223479]
Predicted Effect probably damaging
Transcript: ENSMUST00000021843
AA Change: F66S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021843
Gene: ENSMUSG00000046949
AA Change: F66S

DomainStartEndE-ValueType
Pfam:FMN_red 4 159 5.6e-15 PFAM
Pfam:Flavodoxin_2 4 212 3.5e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000058978
AA Change: F66S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000053809
Gene: ENSMUSG00000046949
AA Change: F66S

DomainStartEndE-ValueType
Pfam:FMN_red 4 158 2e-14 PFAM
Pfam:Flavodoxin_2 4 212 2.6e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076532
SMART Domains Protein: ENSMUSP00000075848
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
SERPIN 13 378 2.84e-179 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166354
SMART Domains Protein: ENSMUSP00000126287
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
Pfam:Serpin 6 66 3.8e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167597
Predicted Effect probably benign
Transcript: ENSMUST00000168400
SMART Domains Protein: ENSMUSP00000126450
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
Pfam:Serpin 6 120 3.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171034
SMART Domains Protein: ENSMUSP00000132433
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
SERPIN 13 228 3.54e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000220844
AA Change: F22S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000222740
AA Change: F66S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000223479
AA Change: F66S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.268 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 94% (32/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the thioredoxin family of enzymes. It is a cytosolic and ubiquitously expressed flavoprotein that catalyzes the two-electron reduction of quinone substrates and uses dihydronicotinamide riboside as a reducing coenzyme. Mutations in this gene have been associated with neurodegenerative diseases and several cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygouse for disruptions in this gene have an essentially normal phenotype but with abnormalities in WBC counts and increased susceptibility to chemically induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,176,489 H150R probably benign Het
Acbd5 C T 2: 23,069,080 probably benign Het
Adcyap1r1 G A 6: 55,479,994 V237M probably damaging Het
Akr1c6 T G 13: 4,449,319 probably null Het
BC037034 G T 5: 138,263,458 probably null Het
Ccdc7b T A 8: 129,166,981 F96L probably benign Het
Cubn T C 2: 13,310,673 H2983R possibly damaging Het
Dhx40 T A 11: 86,804,349 I112L possibly damaging Het
Dnmbp A T 19: 43,856,586 D1070E probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ep300 G C 15: 81,586,713 D29H unknown Het
Exoc3 T C 13: 74,189,158 probably null Het
Fuk A T 8: 110,893,283 probably null Het
Gm6401 C A 14: 41,966,864 E83* probably null Het
Gm8267 G T 14: 44,717,910 T218K possibly damaging Het
Hif3a T A 7: 17,042,605 D470V possibly damaging Het
Hist1h1d T C 13: 23,555,277 probably null Het
Igf2r T C 17: 12,698,618 S1526G possibly damaging Het
Lrp2 T C 2: 69,469,405 D3101G probably damaging Het
Megf6 A G 4: 154,258,087 probably null Het
Mthfs G A 9: 89,239,908 G149D probably damaging Het
Nnmt T C 9: 48,603,369 D116G probably benign Het
Olfr389 T A 11: 73,776,680 M216L probably benign Het
Olfr869 T C 9: 20,137,943 S276P probably damaging Het
Parm1 T C 5: 91,593,859 S29P possibly damaging Het
Prokr2 C T 2: 132,373,549 V331M possibly damaging Het
Ptch1 T A 13: 63,523,104 I871F probably damaging Het
Rps6ka5 C A 12: 100,597,909 G227V probably damaging Het
Tcaim C T 9: 122,834,779 Q445* probably null Het
Trpc7 T C 13: 56,810,380 probably null Het
Ubxn7 A G 16: 32,384,925 E465G probably damaging Het
Unk G A 11: 116,047,802 R77Q probably damaging Het
Vmn1r226 A T 17: 20,688,289 N261I probably benign Het
Vmn1r87 T A 7: 13,131,959 K134* probably null Het
Vmn2r10 T A 5: 108,996,078 I669L probably benign Het
Vmn2r115 A G 17: 23,346,032 I298V probably benign Het
Yipf2 T C 9: 21,589,848 K85E probably damaging Het
Zfp979 A T 4: 147,613,626 C209S probably benign Het
Other mutations in Nqo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02135:Nqo2 APN 13 33985343 nonsense probably null
IGL02884:Nqo2 APN 13 33972361 missense probably damaging 1.00
R0021:Nqo2 UTSW 13 33981507 missense probably benign
R0021:Nqo2 UTSW 13 33981507 missense probably benign
R0848:Nqo2 UTSW 13 33972478 critical splice donor site probably null
R0853:Nqo2 UTSW 13 33979577 missense probably benign
R3417:Nqo2 UTSW 13 33979633 missense probably benign 0.01
R4110:Nqo2 UTSW 13 33979637 missense probably benign 0.00
R4936:Nqo2 UTSW 13 33981518 missense probably damaging 1.00
R5861:Nqo2 UTSW 13 33972430 missense probably damaging 1.00
R6161:Nqo2 UTSW 13 33979651 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGAAGCACTCTTACCAGTGTTC -3'
(R):5'- CAGTTCCAAAAGCAGTGTTCAAG -3'

Sequencing Primer
(F):5'- AGCCTTCTCTGTCAGCCTGATTG -3'
(R):5'- CAAGATCAGCTTCTTGCAC -3'
Posted On2018-06-22