Incidental Mutation 'R6631:Pomt2'
ID525154
Institutional Source Beutler Lab
Gene Symbol Pomt2
Ensembl Gene ENSMUSG00000034126
Gene Nameprotein-O-mannosyltransferase 2
SynonymsA830009D15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6631 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location87106861-87147968 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 87139643 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000035260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037788] [ENSMUST00000222634]
Predicted Effect probably null
Transcript: ENSMUST00000037788
SMART Domains Protein: ENSMUSP00000035260
Gene: ENSMUSG00000034126

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
Pfam:PMT 132 376 5.4e-91 PFAM
MIR 404 460 4.05e-9 SMART
MIR 473 529 5.52e-11 SMART
MIR 534 591 1.21e-7 SMART
Pfam:PMT_4TMC 608 818 5.9e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222147
Predicted Effect probably benign
Transcript: ENSMUST00000222634
Meta Mutation Damage Score 0.9497 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: This gene encodes an integral membrane protein that belongs to the dolichyl-phosphate-mannose-protein mannosyltransferase family. The encoded enzyme is found in the membrane of the endoplasmic reticulum. This protein is a component of the protein O-mannosyltransferase enzyme complex which is involved in modification of the protein alpha-dystroglycan. Mutations in the human gene are a cause of different forms of muscular dystrophy-dystroglycanopathy (MDDG), type A2 (also known as Walker-Warburg syndrome), type B2 and type C2 (also known as limb-girdle muscular dystrophy). [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for one knock-out allele die between E8.5 and E9.5 with abnormal Reichert's membrane and runting. Mice homozygous for another allele die before implantation and arrest at the morula stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik A T 9: 15,292,030 N159K probably damaging Het
Arhgef10l T C 4: 140,517,747 probably benign Het
Avil A G 10: 127,007,749 S153G possibly damaging Het
C2cd3 G A 7: 100,418,540 D877N probably damaging Het
Clca3a2 G A 3: 144,813,644 A257V probably benign Het
Cramp1l T A 17: 24,983,957 H366L probably benign Het
Cyp2c37 C T 19: 40,009,843 S393L probably damaging Het
Defb8 T A 8: 19,445,934 I37L probably benign Het
Dennd4b C A 3: 90,277,732 probably null Het
Eps8l2 G A 7: 141,356,202 R223H probably damaging Het
Erbin A G 13: 103,824,892 L1302P probably benign Het
Exoc3l A G 8: 105,295,361 W37R probably damaging Het
Fam214a A G 9: 74,953,825 D4G possibly damaging Het
Fap T C 2: 62,503,381 N668S probably damaging Het
Gas7 A G 11: 67,674,281 N250S probably damaging Het
Hist1h2bk T A 13: 22,036,221 V112E probably damaging Het
Hivep1 C A 13: 42,156,480 P732Q probably damaging Het
Irx4 G T 13: 73,268,426 A314S probably benign Het
Itgb8 A T 12: 119,180,977 L332* probably null Het
Kctd19 A G 8: 105,385,328 probably null Het
Kif14 G A 1: 136,515,959 S1290N probably benign Het
Klk1b3 C T 7: 44,201,464 T140I probably benign Het
Lama1 A G 17: 67,774,482 N1305D probably benign Het
Lrp1 A T 10: 127,574,332 V1515E probably damaging Het
Man2b1 A G 8: 85,086,811 probably null Het
Mocos A G 18: 24,699,931 T818A probably benign Het
Mpc2 G T 1: 165,479,512 W94L probably benign Het
Mrc1 G A 2: 14,238,485 V141I probably benign Het
Nalcn T C 14: 123,460,251 T538A probably benign Het
Ndufs3 G A 2: 90,902,400 T114M probably damaging Het
Noct T C 3: 51,250,200 C320R probably damaging Het
Olfr1472 T A 19: 13,453,821 Q232L probably benign Het
Pcdha11 G T 18: 37,005,791 A158S probably damaging Het
Pcdhga8 T A 18: 37,727,056 D388E probably benign Het
Peg3 T C 7: 6,709,070 E1051G possibly damaging Het
Phlda2 T A 7: 143,502,181 I104F probably damaging Het
Polr2a A G 11: 69,735,513 S1604P possibly damaging Het
Ppp6r2 G A 15: 89,253,255 probably null Het
Prdm2 T G 4: 143,134,884 Q612P probably benign Het
Prr5 C A 15: 84,702,777 R243S probably damaging Het
Ptgdr2 T C 19: 10,940,869 I250T probably benign Het
Rad54l2 A T 9: 106,713,540 C462* probably null Het
Sec16a T A 2: 26,439,957 E682V probably damaging Het
Serpina3i A G 12: 104,266,466 D210G probably damaging Het
Slain2 T A 5: 72,957,405 D326E probably benign Het
Sned1 A G 1: 93,281,652 E829G probably damaging Het
Steap4 G A 5: 7,976,995 W319* probably null Het
Taar8c A G 10: 24,101,803 V37A probably benign Het
Tdrd12 T A 7: 35,485,229 Y753F probably damaging Het
Tnxb A G 17: 34,718,248 S3770G probably damaging Het
Trrap A G 5: 144,771,650 N48S possibly damaging Het
Zfp558 C A 9: 18,456,923 G190* probably null Het
Other mutations in Pomt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Pomt2 APN 12 87124856 missense probably damaging 1.00
IGL00508:Pomt2 APN 12 87119627 missense probably damaging 1.00
IGL01069:Pomt2 APN 12 87110304 missense probably damaging 1.00
IGL01688:Pomt2 APN 12 87147520 missense probably benign
IGL01887:Pomt2 APN 12 87119589 missense probably damaging 1.00
IGL02120:Pomt2 APN 12 87111552 missense probably benign 0.07
IGL02233:Pomt2 APN 12 87111411 missense probably benign 0.00
IGL02305:Pomt2 APN 12 87117929 splice site probably benign
IGL02372:Pomt2 APN 12 87122835 splice site probably benign
IGL02516:Pomt2 APN 12 87119646 missense probably benign 0.00
IGL02616:Pomt2 APN 12 87124862 missense probably damaging 1.00
IGL03039:Pomt2 APN 12 87110366 missense probably benign 0.03
IGL03385:Pomt2 APN 12 87116556 missense probably damaging 1.00
PIT4366001:Pomt2 UTSW 12 87116529 critical splice donor site probably null
R1055:Pomt2 UTSW 12 87147480 missense possibly damaging 0.49
R1716:Pomt2 UTSW 12 87124836 missense probably benign 0.03
R1880:Pomt2 UTSW 12 87135596 missense probably damaging 1.00
R1881:Pomt2 UTSW 12 87135596 missense probably damaging 1.00
R2011:Pomt2 UTSW 12 87111399 missense possibly damaging 0.95
R2443:Pomt2 UTSW 12 87133380 missense probably damaging 1.00
R2913:Pomt2 UTSW 12 87128969 missense probably damaging 0.98
R4036:Pomt2 UTSW 12 87111522 critical splice donor site probably null
R4482:Pomt2 UTSW 12 87131830 missense probably benign 0.41
R4647:Pomt2 UTSW 12 87118083 missense possibly damaging 0.49
R4758:Pomt2 UTSW 12 87122878 missense probably damaging 1.00
R4872:Pomt2 UTSW 12 87110107 missense possibly damaging 0.89
R5071:Pomt2 UTSW 12 87133460 missense probably damaging 0.96
R5074:Pomt2 UTSW 12 87133460 missense probably damaging 0.96
R5132:Pomt2 UTSW 12 87110347 missense probably damaging 0.98
R5514:Pomt2 UTSW 12 87129023 missense probably damaging 1.00
R5790:Pomt2 UTSW 12 87127378 missense probably damaging 1.00
R6128:Pomt2 UTSW 12 87111335 critical splice donor site probably null
R6370:Pomt2 UTSW 12 87109199 missense probably damaging 1.00
R6979:Pomt2 UTSW 12 87130351 missense probably damaging 1.00
R7057:Pomt2 UTSW 12 87127378 missense probably damaging 0.96
R7114:Pomt2 UTSW 12 87110376 missense probably damaging 1.00
R7690:Pomt2 UTSW 12 87130367 missense probably damaging 1.00
R7864:Pomt2 UTSW 12 87122882 missense probably benign 0.00
R8060:Pomt2 UTSW 12 87129006 missense probably damaging 1.00
R8695:Pomt2 UTSW 12 87110016 missense probably benign 0.12
R8851:Pomt2 UTSW 12 87138064 missense probably damaging 0.99
X0026:Pomt2 UTSW 12 87111375 missense possibly damaging 0.93
Z1177:Pomt2 UTSW 12 87111442 missense possibly damaging 0.74
Z1177:Pomt2 UTSW 12 87139681 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCATTTCTGAGCCCAGA -3'
(R):5'- TAAGATGGGGCAAAGTGTTCACAC -3'

Sequencing Primer
(F):5'- TCTGAGCCCAGAGAACCC -3'
(R):5'- TCTGGGCTAATATCCACTTATCAG -3'
Posted On2018-06-22