Incidental Mutation 'R6599:Igf2r'
ID 525155
Institutional Source Beutler Lab
Gene Symbol Igf2r
Ensembl Gene ENSMUSG00000023830
Gene Name insulin-like growth factor 2 receptor
Synonyms IGF-II/CI-MPR, CD222, mannose-6-phosphate receptor, cation independent, M6P/IGF2R, Mpr300, CI-MPR
MMRRC Submission 044723-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.905) question?
Stock # R6599 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 12901293-12988551 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 12917505 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 1526 (S1526G)
Ref Sequence ENSEMBL: ENSMUSP00000024599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024599]
AlphaFold Q07113
Predicted Effect possibly damaging
Transcript: ENSMUST00000024599
AA Change: S1526G

PolyPhen 2 Score 0.850 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000024599
Gene: ENSMUSG00000023830
AA Change: S1526G

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
low complexity region 94 104 N/A INTRINSIC
Pfam:CIMR 118 266 5.1e-21 PFAM
Pfam:CIMR 272 416 8.8e-22 PFAM
Pfam:CIMR 418 567 3.4e-53 PFAM
Pfam:CIMR 569 709 6.5e-47 PFAM
Pfam:CIMR 713 869 6.5e-34 PFAM
Pfam:CIMR 876 1020 1.9e-10 PFAM
Pfam:CIMR 1024 1171 1e-60 PFAM
Pfam:CIMR 1172 1313 1.2e-17 PFAM
Pfam:CIMR 1315 1455 2.1e-58 PFAM
Pfam:CIMR 1458 1592 1.8e-22 PFAM
Pfam:CIMR 1596 1743 9.1e-23 PFAM
Pfam:CIMR 1748 1887 2.5e-22 PFAM
FN2 1889 1935 9.51e-26 SMART
Pfam:CIMR 1939 2076 2.1e-22 PFAM
Pfam:CIMR 2230 2294 4.9e-9 PFAM
transmembrane domain 2295 2317 N/A INTRINSIC
low complexity region 2336 2363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161738
SMART Domains Protein: ENSMUSP00000124664
Gene: ENSMUSG00000023830

DomainStartEndE-ValueType
Pfam:CIMR 1 65 3.1e-24 PFAM
Pfam:CIMR 68 129 6.1e-15 PFAM
Meta Mutation Damage Score 0.1768 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 94% (32/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for both insulin-like growth factor 2 and mannose 6-phosphate. The binding sites for each ligand are located on different segments of the protein. This receptor has various functions, including in the intracellular trafficking of lysosomal enzymes, the activation of transforming growth factor beta, and the degradation of insulin-like growth factor 2. Mutation or loss of heterozygosity of this gene has been association with risk of hepatocellular carcinoma. The orthologous mouse gene is imprinted and shows exclusive expression from the maternal allele; however, imprinting of the human gene may be polymorphic, as only a minority of individuals showed biased expression from the maternal allele (PMID:8267611). [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutants inheriting maternally a targeted disruption of this gene exhibit elevated serum and tissue IGF-II levels, overgrowth, organomegaly, kinky tail, polydactyly, heart defects, edema, dyspnea, imperforate vagina, reduced fertility and perinatal death.Survival is influenced by genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(6)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 137,882,250 (GRCm39) H150R probably benign Het
Acbd5 C T 2: 22,959,092 (GRCm39) probably benign Het
Adcyap1r1 G A 6: 55,456,979 (GRCm39) V237M probably damaging Het
Akr1c6 T G 13: 4,499,318 (GRCm39) probably null Het
Ccdc7b T A 8: 129,893,462 (GRCm39) F96L probably benign Het
Cubn T C 2: 13,315,484 (GRCm39) H2983R possibly damaging Het
Dhx40 T A 11: 86,695,175 (GRCm39) I112L possibly damaging Het
Dnmbp A T 19: 43,845,025 (GRCm39) D1070E probably damaging Het
Eml2 G A 7: 18,935,088 (GRCm39) V432I probably damaging Het
Ep300 G C 15: 81,470,914 (GRCm39) D29H unknown Het
Exoc3 T C 13: 74,337,277 (GRCm39) probably null Het
Fcsk A T 8: 111,619,915 (GRCm39) probably null Het
Gm6401 C A 14: 41,788,821 (GRCm39) E83* probably null Het
Gm8267 G T 14: 44,955,367 (GRCm39) T218K possibly damaging Het
H1f3 T C 13: 23,739,451 (GRCm39) probably null Het
Hif3a T A 7: 16,776,530 (GRCm39) D470V possibly damaging Het
Lrp2 T C 2: 69,299,749 (GRCm39) D3101G probably damaging Het
Megf6 A G 4: 154,342,544 (GRCm39) probably null Het
Mthfs G A 9: 89,121,961 (GRCm39) G149D probably damaging Het
Nnmt T C 9: 48,514,669 (GRCm39) D116G probably benign Het
Nqo2 T C 13: 34,163,539 (GRCm39) F22S probably damaging Het
Or1e29 T A 11: 73,667,506 (GRCm39) M216L probably benign Het
Or7e175 T C 9: 20,049,239 (GRCm39) S276P probably damaging Het
Parm1 T C 5: 91,741,718 (GRCm39) S29P possibly damaging Het
Prokr2 C T 2: 132,215,469 (GRCm39) V331M possibly damaging Het
Ptch1 T A 13: 63,670,918 (GRCm39) I871F probably damaging Het
Rps6ka5 C A 12: 100,564,168 (GRCm39) G227V probably damaging Het
Tcaim C T 9: 122,663,844 (GRCm39) Q445* probably null Het
Trappc14 G T 5: 138,261,720 (GRCm39) probably null Het
Trpc7 T C 13: 56,958,193 (GRCm39) probably null Het
Ubxn7 A G 16: 32,203,743 (GRCm39) E465G probably damaging Het
Unk G A 11: 115,938,628 (GRCm39) R77Q probably damaging Het
Vmn1r226 A T 17: 20,908,551 (GRCm39) N261I probably benign Het
Vmn1r87 T A 7: 12,865,886 (GRCm39) K134* probably null Het
Vmn2r10 T A 5: 109,143,944 (GRCm39) I669L probably benign Het
Vmn2r115 A G 17: 23,565,006 (GRCm39) I298V probably benign Het
Yipf2 T C 9: 21,501,144 (GRCm39) K85E probably damaging Het
Zfp979 A T 4: 147,698,083 (GRCm39) C209S probably benign Het
Other mutations in Igf2r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Igf2r APN 17 12,932,877 (GRCm39) missense probably benign 0.01
IGL00534:Igf2r APN 17 12,958,215 (GRCm39) missense probably damaging 0.97
IGL00902:Igf2r APN 17 12,919,245 (GRCm39) missense probably damaging 0.99
IGL00903:Igf2r APN 17 12,902,754 (GRCm39) missense possibly damaging 0.70
IGL01160:Igf2r APN 17 12,923,662 (GRCm39) missense possibly damaging 0.73
IGL01380:Igf2r APN 17 12,914,261 (GRCm39) missense probably benign 0.01
IGL01392:Igf2r APN 17 12,923,236 (GRCm39) missense probably benign
IGL01557:Igf2r APN 17 12,923,522 (GRCm39) missense possibly damaging 0.82
IGL01568:Igf2r APN 17 12,902,872 (GRCm39) missense possibly damaging 0.93
IGL01611:Igf2r APN 17 12,944,302 (GRCm39) nonsense probably null
IGL01720:Igf2r APN 17 12,920,200 (GRCm39) missense probably damaging 0.99
IGL01756:Igf2r APN 17 12,902,709 (GRCm39) missense probably benign
IGL01839:Igf2r APN 17 12,923,909 (GRCm39) missense probably damaging 1.00
IGL01904:Igf2r APN 17 12,933,798 (GRCm39) missense probably damaging 0.99
IGL01965:Igf2r APN 17 12,923,225 (GRCm39) missense probably benign 0.12
IGL02083:Igf2r APN 17 12,912,079 (GRCm39) nonsense probably null
IGL02095:Igf2r APN 17 12,920,892 (GRCm39) missense probably damaging 0.99
IGL02183:Igf2r APN 17 12,917,403 (GRCm39) unclassified probably benign
IGL02576:Igf2r APN 17 12,967,650 (GRCm39) missense possibly damaging 0.90
IGL02649:Igf2r APN 17 12,930,974 (GRCm39) missense possibly damaging 0.93
IGL02807:Igf2r APN 17 12,938,770 (GRCm39) missense probably damaging 0.98
IGL02833:Igf2r APN 17 12,911,610 (GRCm39) missense probably damaging 0.97
IGL02885:Igf2r APN 17 12,913,007 (GRCm39) missense possibly damaging 0.94
IGL02990:Igf2r APN 17 12,929,633 (GRCm39) splice site probably benign
IGL03080:Igf2r APN 17 12,945,563 (GRCm39) missense probably benign 0.06
IGL03176:Igf2r APN 17 12,935,559 (GRCm39) missense probably damaging 1.00
blunt UTSW 17 12,941,062 (GRCm39) missense probably benign 0.02
brusque UTSW 17 12,933,838 (GRCm39) missense probably damaging 0.98
gruff UTSW 17 12,902,984 (GRCm39) missense probably damaging 0.96
outlier UTSW 17 12,914,201 (GRCm39) missense probably benign 0.20
NA:Igf2r UTSW 17 12,910,849 (GRCm39) missense probably benign
R0165:Igf2r UTSW 17 12,917,414 (GRCm39) missense probably benign 0.07
R0412:Igf2r UTSW 17 12,902,835 (GRCm39) missense probably damaging 0.98
R0523:Igf2r UTSW 17 12,910,951 (GRCm39) missense probably benign 0.27
R0631:Igf2r UTSW 17 12,936,161 (GRCm39) splice site probably null
R0722:Igf2r UTSW 17 12,934,382 (GRCm39) critical splice acceptor site probably null
R0894:Igf2r UTSW 17 12,910,988 (GRCm39) missense probably benign 0.02
R1265:Igf2r UTSW 17 12,913,011 (GRCm39) missense probably damaging 0.98
R1466:Igf2r UTSW 17 12,936,156 (GRCm39) splice site probably benign
R1485:Igf2r UTSW 17 12,910,172 (GRCm39) missense probably damaging 1.00
R1633:Igf2r UTSW 17 12,945,196 (GRCm39) missense probably benign
R1693:Igf2r UTSW 17 12,923,203 (GRCm39) missense probably damaging 0.97
R1751:Igf2r UTSW 17 12,916,328 (GRCm39) missense possibly damaging 0.94
R1843:Igf2r UTSW 17 12,923,157 (GRCm39) critical splice donor site probably null
R1981:Igf2r UTSW 17 12,952,790 (GRCm39) nonsense probably null
R1994:Igf2r UTSW 17 12,911,625 (GRCm39) missense probably benign
R2060:Igf2r UTSW 17 12,920,206 (GRCm39) missense possibly damaging 0.92
R2108:Igf2r UTSW 17 12,917,138 (GRCm39) missense probably benign 0.02
R2132:Igf2r UTSW 17 12,941,095 (GRCm39) missense probably benign 0.12
R2314:Igf2r UTSW 17 12,934,830 (GRCm39) missense probably benign 0.28
R2349:Igf2r UTSW 17 12,941,198 (GRCm39) splice site probably null
R2696:Igf2r UTSW 17 12,914,231 (GRCm39) missense possibly damaging 0.96
R2864:Igf2r UTSW 17 12,905,611 (GRCm39) missense probably damaging 0.99
R2865:Igf2r UTSW 17 12,905,611 (GRCm39) missense probably damaging 0.99
R3884:Igf2r UTSW 17 12,928,355 (GRCm39) missense probably benign
R3930:Igf2r UTSW 17 12,924,716 (GRCm39) missense probably benign 0.01
R4021:Igf2r UTSW 17 12,967,638 (GRCm39) missense probably damaging 0.97
R4125:Igf2r UTSW 17 12,921,141 (GRCm39) missense possibly damaging 0.93
R4342:Igf2r UTSW 17 12,928,398 (GRCm39) missense possibly damaging 0.95
R4343:Igf2r UTSW 17 12,928,398 (GRCm39) missense possibly damaging 0.95
R4345:Igf2r UTSW 17 12,928,398 (GRCm39) missense possibly damaging 0.95
R4760:Igf2r UTSW 17 12,922,352 (GRCm39) missense possibly damaging 0.92
R4796:Igf2r UTSW 17 12,903,013 (GRCm39) missense possibly damaging 0.70
R4816:Igf2r UTSW 17 12,902,984 (GRCm39) missense probably damaging 0.96
R4826:Igf2r UTSW 17 12,920,240 (GRCm39) missense probably damaging 0.98
R4933:Igf2r UTSW 17 12,910,764 (GRCm39) splice site probably null
R4980:Igf2r UTSW 17 12,922,247 (GRCm39) critical splice donor site probably null
R5389:Igf2r UTSW 17 12,944,303 (GRCm39) missense probably damaging 1.00
R5473:Igf2r UTSW 17 12,914,201 (GRCm39) missense probably benign 0.20
R5494:Igf2r UTSW 17 12,912,032 (GRCm39) missense possibly damaging 0.74
R5619:Igf2r UTSW 17 12,958,221 (GRCm39) missense probably damaging 1.00
R5738:Igf2r UTSW 17 12,936,254 (GRCm39) missense probably benign 0.23
R5761:Igf2r UTSW 17 12,917,239 (GRCm39) splice site probably null
R5794:Igf2r UTSW 17 12,928,332 (GRCm39) missense probably benign 0.37
R6210:Igf2r UTSW 17 12,933,838 (GRCm39) missense probably damaging 0.98
R6319:Igf2r UTSW 17 12,933,000 (GRCm39) missense probably damaging 1.00
R6388:Igf2r UTSW 17 12,902,787 (GRCm39) missense probably benign
R6396:Igf2r UTSW 17 12,932,977 (GRCm39) missense probably benign 0.00
R6584:Igf2r UTSW 17 12,920,137 (GRCm39) missense probably damaging 0.99
R6590:Igf2r UTSW 17 12,910,824 (GRCm39) nonsense probably null
R6591:Igf2r UTSW 17 12,907,895 (GRCm39) missense probably damaging 1.00
R6690:Igf2r UTSW 17 12,910,824 (GRCm39) nonsense probably null
R6691:Igf2r UTSW 17 12,907,895 (GRCm39) missense probably damaging 1.00
R6752:Igf2r UTSW 17 12,933,831 (GRCm39) missense probably damaging 1.00
R6816:Igf2r UTSW 17 12,932,969 (GRCm39) missense probably damaging 0.99
R6841:Igf2r UTSW 17 12,922,263 (GRCm39) missense probably damaging 0.97
R6877:Igf2r UTSW 17 12,916,228 (GRCm39) missense probably damaging 0.97
R6950:Igf2r UTSW 17 12,937,605 (GRCm39) missense probably benign
R7030:Igf2r UTSW 17 12,952,753 (GRCm39) missense probably damaging 1.00
R7038:Igf2r UTSW 17 12,917,212 (GRCm39) missense probably benign 0.23
R7055:Igf2r UTSW 17 12,923,210 (GRCm39) missense probably damaging 0.99
R7074:Igf2r UTSW 17 12,933,003 (GRCm39) missense possibly damaging 0.57
R7348:Igf2r UTSW 17 12,922,371 (GRCm39) missense probably damaging 0.99
R7413:Igf2r UTSW 17 12,917,115 (GRCm39) nonsense probably null
R7463:Igf2r UTSW 17 12,929,532 (GRCm39) missense probably benign 0.16
R7619:Igf2r UTSW 17 12,917,160 (GRCm39) missense possibly damaging 0.88
R7730:Igf2r UTSW 17 12,954,878 (GRCm39) missense probably damaging 0.98
R7733:Igf2r UTSW 17 12,958,256 (GRCm39) missense possibly damaging 0.90
R7881:Igf2r UTSW 17 12,967,591 (GRCm39) missense probably benign
R8022:Igf2r UTSW 17 12,937,682 (GRCm39) missense probably damaging 1.00
R8138:Igf2r UTSW 17 12,920,125 (GRCm39) missense probably benign 0.32
R8220:Igf2r UTSW 17 12,910,958 (GRCm39) missense probably benign 0.22
R8305:Igf2r UTSW 17 12,952,747 (GRCm39) missense probably benign
R8359:Igf2r UTSW 17 12,902,748 (GRCm39) missense probably benign
R8500:Igf2r UTSW 17 12,928,328 (GRCm39) missense probably damaging 0.99
R8510:Igf2r UTSW 17 12,923,200 (GRCm39) missense probably benign 0.38
R8933:Igf2r UTSW 17 12,923,524 (GRCm39) missense probably damaging 1.00
R8933:Igf2r UTSW 17 12,920,131 (GRCm39) missense probably damaging 0.97
R8976:Igf2r UTSW 17 12,945,659 (GRCm39) missense probably damaging 1.00
R8994:Igf2r UTSW 17 12,935,537 (GRCm39) missense possibly damaging 0.87
R9059:Igf2r UTSW 17 12,970,180 (GRCm39) start codon destroyed probably null
R9097:Igf2r UTSW 17 12,910,100 (GRCm39) missense probably damaging 1.00
R9127:Igf2r UTSW 17 12,958,238 (GRCm39) missense probably damaging 0.98
R9278:Igf2r UTSW 17 12,914,240 (GRCm39) missense probably damaging 1.00
R9362:Igf2r UTSW 17 12,941,062 (GRCm39) missense probably benign 0.02
R9371:Igf2r UTSW 17 12,924,646 (GRCm39) missense possibly damaging 0.93
R9522:Igf2r UTSW 17 12,917,215 (GRCm39) missense probably benign 0.26
R9567:Igf2r UTSW 17 12,905,641 (GRCm39) missense probably damaging 1.00
R9665:Igf2r UTSW 17 12,913,027 (GRCm39) missense probably benign 0.17
R9666:Igf2r UTSW 17 12,945,588 (GRCm39) missense probably benign
X0028:Igf2r UTSW 17 12,923,800 (GRCm39) nonsense probably null
Z1177:Igf2r UTSW 17 12,916,286 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCTAACTACTGCAAGGGCC -3'
(R):5'- ATGATGACAGCGACAGTGGC -3'

Sequencing Primer
(F):5'- TACTGCAAGGGCCGGGAG -3'
(R):5'- AGACCGTGGTCCAGTGACAG -3'
Posted On 2018-06-22