Incidental Mutation 'R6599:Vmn1r226'
ID525157
Institutional Source Beutler Lab
Gene Symbol Vmn1r226
Ensembl Gene ENSMUSG00000042848
Gene Namevomeronasal 1 receptor 226
SynonymsV1re2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6599 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location20687508-20688404 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20688289 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 261 (N261I)
Ref Sequence ENSEMBL: ENSMUSP00000058266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061756]
Predicted Effect probably benign
Transcript: ENSMUST00000061756
AA Change: N261I

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000058266
Gene: ENSMUSG00000042848
AA Change: N261I

DomainStartEndE-ValueType
Pfam:TAS2R 1 286 5.2e-12 PFAM
Pfam:7tm_1 22 285 9.1e-7 PFAM
Pfam:V1R 33 292 8.7e-26 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 94% (32/34)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,176,489 H150R probably benign Het
Acbd5 C T 2: 23,069,080 probably benign Het
Adcyap1r1 G A 6: 55,479,994 V237M probably damaging Het
Akr1c6 T G 13: 4,449,319 probably null Het
BC037034 G T 5: 138,263,458 probably null Het
Ccdc7b T A 8: 129,166,981 F96L probably benign Het
Cubn T C 2: 13,310,673 H2983R possibly damaging Het
Dhx40 T A 11: 86,804,349 I112L possibly damaging Het
Dnmbp A T 19: 43,856,586 D1070E probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ep300 G C 15: 81,586,713 D29H unknown Het
Exoc3 T C 13: 74,189,158 probably null Het
Fuk A T 8: 110,893,283 probably null Het
Gm6401 C A 14: 41,966,864 E83* probably null Het
Gm8267 G T 14: 44,717,910 T218K possibly damaging Het
Hif3a T A 7: 17,042,605 D470V possibly damaging Het
Hist1h1d T C 13: 23,555,277 probably null Het
Igf2r T C 17: 12,698,618 S1526G possibly damaging Het
Lrp2 T C 2: 69,469,405 D3101G probably damaging Het
Megf6 A G 4: 154,258,087 probably null Het
Mthfs G A 9: 89,239,908 G149D probably damaging Het
Nnmt T C 9: 48,603,369 D116G probably benign Het
Nqo2 T C 13: 33,979,556 F22S probably damaging Het
Olfr389 T A 11: 73,776,680 M216L probably benign Het
Olfr869 T C 9: 20,137,943 S276P probably damaging Het
Parm1 T C 5: 91,593,859 S29P possibly damaging Het
Prokr2 C T 2: 132,373,549 V331M possibly damaging Het
Ptch1 T A 13: 63,523,104 I871F probably damaging Het
Rps6ka5 C A 12: 100,597,909 G227V probably damaging Het
Tcaim C T 9: 122,834,779 Q445* probably null Het
Trpc7 T C 13: 56,810,380 probably null Het
Ubxn7 A G 16: 32,384,925 E465G probably damaging Het
Unk G A 11: 116,047,802 R77Q probably damaging Het
Vmn1r87 T A 7: 13,131,959 K134* probably null Het
Vmn2r10 T A 5: 108,996,078 I669L probably benign Het
Vmn2r115 A G 17: 23,346,032 I298V probably benign Het
Yipf2 T C 9: 21,589,848 K85E probably damaging Het
Zfp979 A T 4: 147,613,626 C209S probably benign Het
Other mutations in Vmn1r226
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Vmn1r226 APN 17 20687904 missense probably damaging 1.00
IGL02103:Vmn1r226 APN 17 20687664 missense probably damaging 0.98
IGL03394:Vmn1r226 APN 17 20688184 missense probably benign 0.00
R0243:Vmn1r226 UTSW 17 20687577 missense probably benign 0.00
R0605:Vmn1r226 UTSW 17 20687871 missense probably benign 0.12
R1463:Vmn1r226 UTSW 17 20687732 missense probably benign 0.00
R1571:Vmn1r226 UTSW 17 20688276 missense probably damaging 0.97
R1677:Vmn1r226 UTSW 17 20688073 missense probably damaging 1.00
R1917:Vmn1r226 UTSW 17 20687580 missense probably damaging 0.99
R1918:Vmn1r226 UTSW 17 20687580 missense probably damaging 0.99
R1919:Vmn1r226 UTSW 17 20687580 missense probably damaging 0.99
R1980:Vmn1r226 UTSW 17 20688046 missense possibly damaging 0.81
R2291:Vmn1r226 UTSW 17 20688213 missense probably damaging 1.00
R2377:Vmn1r226 UTSW 17 20687730 missense probably benign 0.05
R3878:Vmn1r226 UTSW 17 20687998 missense possibly damaging 0.79
R5166:Vmn1r226 UTSW 17 20687863 missense probably benign 0.43
R6510:Vmn1r226 UTSW 17 20687853 missense probably benign 0.37
R7304:Vmn1r226 UTSW 17 20687749 missense probably damaging 1.00
X0066:Vmn1r226 UTSW 17 20688250 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTGCTCATTGTAAGTTCCAGTGC -3'
(R):5'- GACACACATTTTCTAAGACTCACTC -3'

Sequencing Primer
(F):5'- CATTGTAAGTTCCAGTGCTTTTATG -3'
(R):5'- GCAGAATCTGGAAATAGCG -3'
Posted On2018-06-22