Incidental Mutation 'R6631:Nalcn'
ID525168
Institutional Source Beutler Lab
Gene Symbol Nalcn
Ensembl Gene ENSMUSG00000000197
Gene Namesodium leak channel, non-selective
SynonymsA530023G15Rik, Vgcnl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6631 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location123276634-123627144 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123460251 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 538 (T538A)
Ref Sequence ENSEMBL: ENSMUSP00000000201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000201]
Predicted Effect probably benign
Transcript: ENSMUST00000000201
AA Change: T538A

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000000201
Gene: ENSMUSG00000000197
AA Change: T538A

DomainStartEndE-ValueType
Pfam:Ion_trans 35 333 2.8e-37 PFAM
low complexity region 338 348 N/A INTRINSIC
Pfam:Ion_trans 383 609 5.7e-34 PFAM
coiled coil region 796 830 N/A INTRINSIC
Pfam:Ion_trans 885 1166 2.4e-42 PFAM
Pfam:Ion_trans 1209 1458 6.9e-30 PFAM
low complexity region 1548 1560 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228860
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NALCN forms a voltage-independent, nonselective, noninactivating cation channel permeable to Na+, K+, and Ca(2+). It is responsible for the neuronal background sodium leak conductance (Lu et al., 2007 [PubMed 17448995]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal breathing at birth and die within 24 hours. Mice homozygous for a gain of function ENU mutation exhibit reduced the total amount and episode duration of REMS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik A T 9: 15,292,030 N159K probably damaging Het
Arhgef10l T C 4: 140,517,747 probably benign Het
Avil A G 10: 127,007,749 S153G possibly damaging Het
C2cd3 G A 7: 100,418,540 D877N probably damaging Het
Clca3a2 G A 3: 144,813,644 A257V probably benign Het
Cramp1l T A 17: 24,983,957 H366L probably benign Het
Cyp2c37 C T 19: 40,009,843 S393L probably damaging Het
Defb8 T A 8: 19,445,934 I37L probably benign Het
Dennd4b C A 3: 90,277,732 probably null Het
Eps8l2 G A 7: 141,356,202 R223H probably damaging Het
Erbin A G 13: 103,824,892 L1302P probably benign Het
Exoc3l A G 8: 105,295,361 W37R probably damaging Het
Fam214a A G 9: 74,953,825 D4G possibly damaging Het
Fap T C 2: 62,503,381 N668S probably damaging Het
Gas7 A G 11: 67,674,281 N250S probably damaging Het
Hist1h2bk T A 13: 22,036,221 V112E probably damaging Het
Hivep1 C A 13: 42,156,480 P732Q probably damaging Het
Irx4 G T 13: 73,268,426 A314S probably benign Het
Itgb8 A T 12: 119,180,977 L332* probably null Het
Kctd19 A G 8: 105,385,328 probably null Het
Kif14 G A 1: 136,515,959 S1290N probably benign Het
Klk1b3 C T 7: 44,201,464 T140I probably benign Het
Lama1 A G 17: 67,774,482 N1305D probably benign Het
Lrp1 A T 10: 127,574,332 V1515E probably damaging Het
Man2b1 A G 8: 85,086,811 probably null Het
Mocos A G 18: 24,699,931 T818A probably benign Het
Mpc2 G T 1: 165,479,512 W94L probably benign Het
Mrc1 G A 2: 14,238,485 V141I probably benign Het
Ndufs3 G A 2: 90,902,400 T114M probably damaging Het
Noct T C 3: 51,250,200 C320R probably damaging Het
Olfr1472 T A 19: 13,453,821 Q232L probably benign Het
Pcdha11 G T 18: 37,005,791 A158S probably damaging Het
Pcdhga8 T A 18: 37,727,056 D388E probably benign Het
Peg3 T C 7: 6,709,070 E1051G possibly damaging Het
Phlda2 T A 7: 143,502,181 I104F probably damaging Het
Polr2a A G 11: 69,735,513 S1604P possibly damaging Het
Pomt2 C T 12: 87,139,643 probably null Het
Ppp6r2 G A 15: 89,253,255 probably null Het
Prdm2 T G 4: 143,134,884 Q612P probably benign Het
Prr5 C A 15: 84,702,777 R243S probably damaging Het
Ptgdr2 T C 19: 10,940,869 I250T probably benign Het
Rad54l2 A T 9: 106,713,540 C462* probably null Het
Sec16a T A 2: 26,439,957 E682V probably damaging Het
Serpina3i A G 12: 104,266,466 D210G probably damaging Het
Slain2 T A 5: 72,957,405 D326E probably benign Het
Sned1 A G 1: 93,281,652 E829G probably damaging Het
Steap4 G A 5: 7,976,995 W319* probably null Het
Taar8c A G 10: 24,101,803 V37A probably benign Het
Tdrd12 T A 7: 35,485,229 Y753F probably damaging Het
Tnxb A G 17: 34,718,248 S3770G probably damaging Het
Trrap A G 5: 144,771,650 N48S possibly damaging Het
Zfp558 C A 9: 18,456,923 G190* probably null Het
Other mutations in Nalcn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Nalcn APN 14 123348789 missense probably benign 0.00
IGL00964:Nalcn APN 14 123295384 splice site probably benign
IGL01310:Nalcn APN 14 123317249 missense probably benign 0.00
IGL01578:Nalcn APN 14 123572091 missense probably benign 0.00
IGL01925:Nalcn APN 14 123291848 missense possibly damaging 0.88
IGL02072:Nalcn APN 14 123323358 missense probably benign 0.05
IGL02096:Nalcn APN 14 123594503 missense probably benign 0.11
IGL02212:Nalcn APN 14 123515330 missense probably damaging 0.99
IGL02306:Nalcn APN 14 123323338 missense probably benign 0.07
IGL02471:Nalcn APN 14 123323314 missense probably benign 0.02
IGL02478:Nalcn APN 14 123321305 missense probably benign 0.26
IGL02551:Nalcn APN 14 123323338 missense probably benign 0.07
IGL02630:Nalcn APN 14 123317879 missense probably benign 0.16
IGL02632:Nalcn APN 14 123317853 missense probably benign 0.11
IGL02661:Nalcn APN 14 123592909 splice site probably benign
IGL02830:Nalcn APN 14 123293469 missense probably damaging 0.98
IGL02939:Nalcn APN 14 123298872 missense probably null 1.00
IGL03035:Nalcn APN 14 123278218 nonsense probably null
IGL03226:Nalcn APN 14 123281115 missense probably benign 0.00
IGL03242:Nalcn APN 14 123321487 missense possibly damaging 0.91
Narnia UTSW 14 123291047 missense probably benign 0.11
R0019:Nalcn UTSW 14 123507489 missense probably benign 0.18
R0144:Nalcn UTSW 14 123371536 missense probably damaging 0.96
R0144:Nalcn UTSW 14 123409839 splice site probably benign
R0359:Nalcn UTSW 14 123299168 missense probably damaging 1.00
R0383:Nalcn UTSW 14 123507559 missense probably benign 0.01
R0400:Nalcn UTSW 14 123290960 splice site probably benign
R0467:Nalcn UTSW 14 123291047 missense probably benign 0.11
R0506:Nalcn UTSW 14 123596614 missense possibly damaging 0.82
R0583:Nalcn UTSW 14 123294343 missense possibly damaging 0.46
R0620:Nalcn UTSW 14 123299141 splice site probably benign
R0624:Nalcn UTSW 14 123370032 missense probably benign
R0883:Nalcn UTSW 14 123464740 missense probably damaging 1.00
R1381:Nalcn UTSW 14 123314105 missense probably damaging 1.00
R1467:Nalcn UTSW 14 123464656 splice site probably benign
R1689:Nalcn UTSW 14 123285254 missense probably damaging 1.00
R1726:Nalcn UTSW 14 123308404 missense probably damaging 1.00
R1774:Nalcn UTSW 14 123278266 missense probably benign
R1854:Nalcn UTSW 14 123460412 missense probably damaging 1.00
R1869:Nalcn UTSW 14 123594553 missense possibly damaging 0.96
R1871:Nalcn UTSW 14 123594553 missense possibly damaging 0.96
R1873:Nalcn UTSW 14 123283601 missense probably benign 0.00
R1899:Nalcn UTSW 14 123316126 missense possibly damaging 0.50
R1915:Nalcn UTSW 14 123302769 missense probably benign 0.08
R2016:Nalcn UTSW 14 123594581 splice site probably null
R2034:Nalcn UTSW 14 123283603 missense probably benign 0.01
R2087:Nalcn UTSW 14 123281145 missense probably benign
R2149:Nalcn UTSW 14 123370017 missense probably benign 0.01
R2157:Nalcn UTSW 14 123409752 missense probably benign 0.32
R2166:Nalcn UTSW 14 123369951 missense probably benign 0.00
R2932:Nalcn UTSW 14 123593018 missense probably benign 0.06
R3408:Nalcn UTSW 14 123596617 missense probably null 0.98
R3778:Nalcn UTSW 14 123464716 missense probably damaging 1.00
R3807:Nalcn UTSW 14 123278187 missense probably damaging 1.00
R3835:Nalcn UTSW 14 123293422 splice site probably benign
R3937:Nalcn UTSW 14 123369945 missense probably benign 0.00
R4001:Nalcn UTSW 14 123596594 missense probably damaging 1.00
R4015:Nalcn UTSW 14 123486387 missense probably damaging 1.00
R4033:Nalcn UTSW 14 123599989 splice site probably benign
R4231:Nalcn UTSW 14 123599913 missense probably benign 0.01
R4464:Nalcn UTSW 14 123323350 missense probably benign
R4512:Nalcn UTSW 14 123295448 missense probably damaging 1.00
R4542:Nalcn UTSW 14 123321477 synonymous silent
R4557:Nalcn UTSW 14 123321235 intron probably benign
R4869:Nalcn UTSW 14 123599884 missense probably benign 0.44
R5083:Nalcn UTSW 14 123323294 splice site probably null
R5109:Nalcn UTSW 14 123278238 missense possibly damaging 0.86
R5131:Nalcn UTSW 14 123515770 missense probably damaging 0.98
R5158:Nalcn UTSW 14 123515737 missense probably damaging 1.00
R5259:Nalcn UTSW 14 123515651 missense possibly damaging 0.94
R5422:Nalcn UTSW 14 123515365 missense probably damaging 1.00
R5514:Nalcn UTSW 14 123283711 missense probably benign 0.14
R5523:Nalcn UTSW 14 123409743 missense probably damaging 1.00
R5551:Nalcn UTSW 14 123278286 missense possibly damaging 0.57
R5667:Nalcn UTSW 14 123295406 missense probably damaging 1.00
R5671:Nalcn UTSW 14 123295406 missense probably damaging 1.00
R5750:Nalcn UTSW 14 123572038 missense probably benign
R5765:Nalcn UTSW 14 123464726 missense possibly damaging 0.46
R6324:Nalcn UTSW 14 123409749 missense possibly damaging 0.83
R6523:Nalcn UTSW 14 123317843 missense probably benign 0.00
R6558:Nalcn UTSW 14 123486507 missense probably benign
R6667:Nalcn UTSW 14 123321323 missense probably damaging 1.00
R6670:Nalcn UTSW 14 123464672 missense possibly damaging 0.96
R6724:Nalcn UTSW 14 123298067 missense probably damaging 0.99
R6731:Nalcn UTSW 14 123599934 missense probably benign 0.22
R6957:Nalcn UTSW 14 123507554 missense probably damaging 0.96
R6970:Nalcn UTSW 14 123314094 missense possibly damaging 0.46
R7010:Nalcn UTSW 14 123293465 missense probably damaging 1.00
R7018:Nalcn UTSW 14 123409821 missense probably damaging 1.00
R7040:Nalcn UTSW 14 123287855 missense probably benign
R7089:Nalcn UTSW 14 123278349 missense probably benign 0.01
R7128:Nalcn UTSW 14 123594502 missense probably damaging 0.99
R7149:Nalcn UTSW 14 123599865 missense probably benign 0.02
R7361:Nalcn UTSW 14 123291839 missense probably benign 0.00
R7378:Nalcn UTSW 14 123302890 missense probably damaging 1.00
R7408:Nalcn UTSW 14 123291860 missense probably benign 0.00
R7470:Nalcn UTSW 14 123572044 missense probably benign 0.09
R7483:Nalcn UTSW 14 123314087 missense probably damaging 1.00
R7521:Nalcn UTSW 14 123293458 missense probably damaging 1.00
R7558:Nalcn UTSW 14 123486385 critical splice donor site probably null
R7585:Nalcn UTSW 14 123515638 missense probably damaging 1.00
R7591:Nalcn UTSW 14 123323885 missense probably benign 0.01
R7761:Nalcn UTSW 14 123294379 missense probably damaging 1.00
R7761:Nalcn UTSW 14 123294380 missense probably damaging 1.00
R7811:Nalcn UTSW 14 123298945 missense probably damaging 1.00
X0060:Nalcn UTSW 14 123285241 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATCCATGTGTACACCAATGG -3'
(R):5'- CATGACTAGGTTCTGCGGGTAG -3'

Sequencing Primer
(F):5'- TACCTGTACCCTGTAGAAGAGGCTG -3'
(R):5'- GGTAGTCCGGCTTATTAAGATTTCCC -3'
Posted On2018-06-22