Mutagenetix > Incidental Mutation

Incidental Mutation 'R6600:Ubr1'

525173

Institutional Source

Beutler Lab

Gene Symbol

Ubr1

Ensembl Gene

ENSMUSG00000027272

Gene Name

ubiquitin protein ligase E3 component n-recognin 1

Synonyms

E3 alpha

MMRRC Submission

044724-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.864) question?

Stock #

R6600 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

120860269-120970715 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 120915399 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 851 (K851N)

Ref Sequence

ENSEMBL: ENSMUSP00000028728 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028728]

AlphaFold

O70481

Predicted Effect

probably benign
Transcript: ENSMUST00000028728
AA Change: K851N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000028728
Gene: ENSMUSG00000027272
AA Change: K851N

Domain	Start	End	E-Value	Type
ZnF_UBR1	97	167	1.24e-35	SMART
Pfam:ClpS	221	301	8e-24	PFAM
low complexity region	918	936	N/A	INTRINSIC
low complexity region	1017	1030	N/A	INTRINSIC
low complexity region	1070	1081	N/A	INTRINSIC
Blast:RING	1101	1203	4e-34	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129790

Meta Mutation Damage Score

0.0601

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.6%

Validation Efficiency

100% (33/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-end rule pathway is one proteolytic pathway of the ubiquitin system. The recognition component of this pathway, encoded by this gene, binds to a destabilizing N-terminal residue of a substrate protein and participates in the formation of a substrate-linked multiubiquitin chain. This leads to the eventual degradation of the substrate protein. The protein described in this record has a RING-type zinc finger and a UBR-type zinc finger. Mutations in this gene have been associated with Johanson-Blizzard syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have 20% lower body weight and reduced muscle and adipose tissue. Skeletal muscle lacks a mechanism for targeting proteins for rapid catabolism. Aberrant regulation of fatty acid synthase upon starvation is also observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430033K04Rik	ACGC	ACGCGC	5: 138,647,448		probably null	Het
Adam1b	C	T	5: 121,501,467	C505Y	probably damaging	Het
Adam24	C	A	8: 40,680,548	H352N	probably damaging	Het
Bcl6b	A	T	11: 70,229,128	L11Q	probably damaging	Het
C2cd5	A	T	6: 143,079,976	V165E	probably damaging	Het
Cacna1d	T	C	14: 30,114,235	N852S	probably benign	Het
Cd320	T	C	17: 33,847,617	C110R	probably damaging	Het
Clasrp	T	A	7: 19,590,282	K223*	probably null	Het
Col5a1	C	A	2: 27,997,571	N951K	unknown	Het
Csn2	T	C	5: 87,694,632	T171A	probably benign	Het
Dse	A	G	10: 34,152,541	I851T	probably benign	Het
Fam168b	C	A	1: 34,836,741	G21V	probably damaging	Het
Fbxo24	T	A	5: 137,612,873	I413F	probably damaging	Het
Flywch2	C	A	17: 23,778,110	G109V	possibly damaging	Het
Fnip1	A	G	11: 54,503,099	D787G	probably benign	Het
Gm12184	A	C	11: 48,826,288	V21G	probably damaging	Het
Gramd1c	T	A	16: 44,040,119	R72*	probably null	Het
Hspd1	T	C	1: 55,078,618	I494V	probably benign	Het
Limch1	T	C	5: 66,745,938	V10A	probably benign	Het
Lrrfip1	C	T	1: 91,115,847	S658F	probably damaging	Het
Naip1	G	A	13: 100,423,070	S1142F	probably benign	Het
Naip1	C	T	13: 100,423,158	G1113S	probably benign	Het
Nlrc3	A	G	16: 3,965,074	I157T	probably benign	Het
Olfr1200	A	G	2: 88,767,757	V186A	probably benign	Het
Pdlim5	T	C	3: 142,259,278	R126G	probably damaging	Het
Pgm2	C	T	4: 99,967,062	R311*	probably null	Het
Ptcd3	T	C	6: 71,883,546	Y559C	probably damaging	Het
Robo1	T	C	16: 72,989,655	S852P	probably damaging	Het
Rps6kb2	A	T	19: 4,158,851	M259K	probably damaging	Het
Sema4b	T	C	7: 80,212,928	L84P	probably benign	Het
Slf1	A	C	13: 77,083,536	S575A	probably benign	Het
Tjap1	T	C	17: 46,259,998	N173S	probably damaging	Het
Trpm1	T	A	7: 64,154,033	M1K	probably null	Het
Zfp568	C	A	7: 30,022,523	R298S	possibly damaging	Het

Other mutations in Ubr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00552:Ubr1	APN	2	120875407	missense	possibly damaging	0.65
IGL00570:Ubr1	APN	2	120941093	missense	possibly damaging	0.93
IGL00990:Ubr1	APN	2	120930872	missense	probably damaging	1.00
IGL01124:Ubr1	APN	2	120914905	missense	probably benign
IGL01346:Ubr1	APN	2	120873122	critical splice donor site	probably null
IGL01368:Ubr1	APN	2	120941131	splice site	probably benign
IGL01539:Ubr1	APN	2	120926013	missense	possibly damaging	0.79
IGL01862:Ubr1	APN	2	120934342	missense	possibly damaging	0.81
IGL01965:Ubr1	APN	2	120875398	missense	probably damaging	0.99
IGL01984:Ubr1	APN	2	120921386	missense	probably damaging	0.99
IGL02184:Ubr1	APN	2	120900508	missense	probably benign	0.00
IGL02208:Ubr1	APN	2	120946349	missense	probably benign	0.00
IGL02415:Ubr1	APN	2	120970603	utr 5 prime	probably benign
IGL02517:Ubr1	APN	2	120864373	missense	possibly damaging	0.69
IGL02614:Ubr1	APN	2	120870979	splice site	probably benign
IGL02627:Ubr1	APN	2	120940991	missense	probably damaging	1.00
IGL02718:Ubr1	APN	2	120914883	missense	probably damaging	1.00
IGL02741:Ubr1	APN	2	120941091	missense	probably benign	0.01
IGL02939:Ubr1	APN	2	120881183	critical splice acceptor site	probably null
IGL03081:Ubr1	APN	2	120961156	missense	possibly damaging	0.83
IGL03310:Ubr1	APN	2	120864417	missense	probably damaging	1.00
IGL03370:Ubr1	APN	2	120895160	missense	probably benign
I1329:Ubr1	UTSW	2	120934294	splice site	probably benign
R0022:Ubr1	UTSW	2	120961173	splice site	probably benign
R0345:Ubr1	UTSW	2	120904103	splice site	probably null
R0373:Ubr1	UTSW	2	120946657	missense	probably benign	0.01
R0393:Ubr1	UTSW	2	120906946	missense	probably damaging	1.00
R0543:Ubr1	UTSW	2	120881093	missense	probably damaging	1.00
R0559:Ubr1	UTSW	2	120947883	nonsense	probably null
R0723:Ubr1	UTSW	2	120881101	nonsense	probably null
R1178:Ubr1	UTSW	2	120926029	nonsense	probably null
R1401:Ubr1	UTSW	2	120955644	missense	probably benign	0.01
R1485:Ubr1	UTSW	2	120961098	missense	probably benign	0.03
R1572:Ubr1	UTSW	2	120935319	splice site	probably benign
R1920:Ubr1	UTSW	2	120930968	missense	probably benign	0.11
R1921:Ubr1	UTSW	2	120930968	missense	probably benign	0.11
R1997:Ubr1	UTSW	2	120946273	critical splice donor site	probably null
R2129:Ubr1	UTSW	2	120942553	missense	probably benign	0.35
R2147:Ubr1	UTSW	2	120864330	missense	probably damaging	1.00
R2191:Ubr1	UTSW	2	120926047	missense	probably damaging	0.96
R2288:Ubr1	UTSW	2	120909482	missense	probably damaging	1.00
R3409:Ubr1	UTSW	2	120963448	missense	probably benign	0.02
R3930:Ubr1	UTSW	2	120916470	missense	probably benign	0.20
R3979:Ubr1	UTSW	2	120862687	missense	probably benign	0.11
R4172:Ubr1	UTSW	2	120946622	splice site	probably null
R4173:Ubr1	UTSW	2	120946622	splice site	probably null
R4174:Ubr1	UTSW	2	120946622	splice site	probably null
R4241:Ubr1	UTSW	2	120934386	missense	possibly damaging	0.69
R4366:Ubr1	UTSW	2	120970603	utr 5 prime	probably benign
R4371:Ubr1	UTSW	2	120895066	splice site	probably null
R4449:Ubr1	UTSW	2	120946381	missense	possibly damaging	0.84
R4533:Ubr1	UTSW	2	120942482	missense	possibly damaging	0.86
R4656:Ubr1	UTSW	2	120926013	missense	probably benign	0.35
R4765:Ubr1	UTSW	2	120963442	nonsense	probably null
R4928:Ubr1	UTSW	2	120914938	missense	probably damaging	1.00
R4987:Ubr1	UTSW	2	120963566	missense	probably benign	0.00
R5033:Ubr1	UTSW	2	120911997	critical splice donor site	probably null
R5108:Ubr1	UTSW	2	120963422	missense	probably benign	0.20
R5118:Ubr1	UTSW	2	120882264	missense	probably benign	0.20
R5211:Ubr1	UTSW	2	120893170	missense	possibly damaging	0.92
R5215:Ubr1	UTSW	2	120904044	missense	probably benign	0.00
R5449:Ubr1	UTSW	2	120963500	missense	probably benign
R5452:Ubr1	UTSW	2	120868302	missense	possibly damaging	0.95
R5582:Ubr1	UTSW	2	120915407	missense	probably benign
R5610:Ubr1	UTSW	2	120892112	missense	probably benign	0.04
R5637:Ubr1	UTSW	2	120963517	missense	possibly damaging	0.68
R5808:Ubr1	UTSW	2	120961092	missense	possibly damaging	0.63
R5845:Ubr1	UTSW	2	120904005	missense	probably benign
R5979:Ubr1	UTSW	2	120946382	missense	probably benign	0.07
R6044:Ubr1	UTSW	2	120862721	missense	probably benign	0.38
R6146:Ubr1	UTSW	2	120893209	missense	probably damaging	0.98
R6252:Ubr1	UTSW	2	120906895	missense	probably benign	0.21
R6389:Ubr1	UTSW	2	120881039	missense	probably benign	0.03
R6670:Ubr1	UTSW	2	120924130	critical splice donor site	probably null
R6731:Ubr1	UTSW	2	120955640	missense	probably null	0.99
R6836:Ubr1	UTSW	2	120896675	splice site	probably null
R6994:Ubr1	UTSW	2	120963593	missense	probably benign
R7121:Ubr1	UTSW	2	120875498	missense	probably benign	0.00
R7204:Ubr1	UTSW	2	120904077	missense	possibly damaging	0.49
R7209:Ubr1	UTSW	2	120862765	missense	probably benign	0.04
R7434:Ubr1	UTSW	2	120862680	missense	probably benign
R7457:Ubr1	UTSW	2	120917828	missense	probably benign	0.35
R7464:Ubr1	UTSW	2	120889774	critical splice donor site	probably null
R7519:Ubr1	UTSW	2	120875444	missense	possibly damaging	0.63
R7574:Ubr1	UTSW	2	120873191	missense	possibly damaging	0.93
R8030:Ubr1	UTSW	2	120934374	missense	probably damaging	0.99
R8085:Ubr1	UTSW	2	120934417	nonsense	probably null
R8221:Ubr1	UTSW	2	120961104	missense	probably damaging	0.97
R8241:Ubr1	UTSW	2	120963456	missense	possibly damaging	0.80
R8291:Ubr1	UTSW	2	120911115	missense	probably benign
R8293:Ubr1	UTSW	2	120862721	missense	probably benign	0.38
R8420:Ubr1	UTSW	2	120870995	missense	probably benign
R8489:Ubr1	UTSW	2	120881067	missense	probably benign	0.42
R8708:Ubr1	UTSW	2	120866483	missense	probably benign	0.27
R8856:Ubr1	UTSW	2	120904042	missense	probably damaging	1.00
R8995:Ubr1	UTSW	2	120866553	missense	probably damaging	1.00
R9153:Ubr1	UTSW	2	120925988	missense	probably benign	0.00
R9155:Ubr1	UTSW	2	120924134	missense	possibly damaging	0.84
R9156:Ubr1	UTSW	2	120873122	critical splice donor site	probably null
R9194:Ubr1	UTSW	2	120947844	missense	probably damaging	1.00
R9320:Ubr1	UTSW	2	120896519	missense	probably benign	0.04
R9401:Ubr1	UTSW	2	120935284	missense	probably benign	0.06
R9430:Ubr1	UTSW	2	120904025	missense	possibly damaging	0.59
R9515:Ubr1	UTSW	2	120873146	missense	probably damaging	1.00
R9623:Ubr1	UTSW	2	120934339	missense	probably benign	0.06
R9703:Ubr1	UTSW	2	120901611	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCTCTCACTCATGTTGGAC -3'
(R):5'- GACTCAAAGAACAGAGGCTAAGTTC -3'

Sequencing Primer
(F):5'- GCTCTCACTCATGTTGGACACATC -3'
(R):5'- GTGGTGCCTTCTCTAAGACAAC -3'

Posted On

2018-06-22