Incidental Mutation 'R6631:Mocos'
ID525180
Institutional Source Beutler Lab
Gene Symbol Mocos
Ensembl Gene ENSMUSG00000039616
Gene Namemolybdenum cofactor sulfurase
Synonyms1110018O12Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_026779.1; MGI:1915841

Is this an essential gene? Possibly non essential (E-score: 0.288) question?
Stock #R6631 (G1)
Quality Score157.009
Status Validated
Chromosome18
Chromosomal Location24653691-24701556 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24699931 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 818 (T818A)
Ref Sequence ENSEMBL: ENSMUSP00000063609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068006]
Predicted Effect probably benign
Transcript: ENSMUST00000068006
AA Change: T818A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000063609
Gene: ENSMUSG00000039616
AA Change: T818A

DomainStartEndE-ValueType
Pfam:Aminotran_5 50 481 7.5e-29 PFAM
Pfam:MOSC_N 569 689 1.1e-32 PFAM
Pfam:MOSC 715 853 3.7e-21 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MOCOS sulfurates the molybdenum cofactor of xanthine dehydrogenase (XDH; MIM 607633) and aldehyde oxidase (AOX1; MIM 602841), which is required for their enzymatic activities (Ichida et al., 2001 [PubMed 11302742]).[supplied by OMIM, Feb 2010]
Allele List at MGI

All alleles(11) : Targeted(1) Gene trapped(10)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik A T 9: 15,292,030 N159K probably damaging Het
Arhgef10l T C 4: 140,517,747 probably benign Het
Avil A G 10: 127,007,749 S153G possibly damaging Het
C2cd3 G A 7: 100,418,540 D877N probably damaging Het
Clca3a2 G A 3: 144,813,644 A257V probably benign Het
Cramp1l T A 17: 24,983,957 H366L probably benign Het
Cyp2c37 C T 19: 40,009,843 S393L probably damaging Het
Defb8 T A 8: 19,445,934 I37L probably benign Het
Dennd4b C A 3: 90,277,732 probably null Het
Eps8l2 G A 7: 141,356,202 R223H probably damaging Het
Erbin A G 13: 103,824,892 L1302P probably benign Het
Exoc3l A G 8: 105,295,361 W37R probably damaging Het
Fam214a A G 9: 74,953,825 D4G possibly damaging Het
Fap T C 2: 62,503,381 N668S probably damaging Het
Gas7 A G 11: 67,674,281 N250S probably damaging Het
Hist1h2bk T A 13: 22,036,221 V112E probably damaging Het
Hivep1 C A 13: 42,156,480 P732Q probably damaging Het
Irx4 G T 13: 73,268,426 A314S probably benign Het
Itgb8 A T 12: 119,180,977 L332* probably null Het
Kctd19 A G 8: 105,385,328 probably null Het
Kif14 G A 1: 136,515,959 S1290N probably benign Het
Klk1b3 C T 7: 44,201,464 T140I probably benign Het
Lama1 A G 17: 67,774,482 N1305D probably benign Het
Lrp1 A T 10: 127,574,332 V1515E probably damaging Het
Man2b1 A G 8: 85,086,811 probably null Het
Mpc2 G T 1: 165,479,512 W94L probably benign Het
Mrc1 G A 2: 14,238,485 V141I probably benign Het
Nalcn T C 14: 123,460,251 T538A probably benign Het
Ndufs3 G A 2: 90,902,400 T114M probably damaging Het
Noct T C 3: 51,250,200 C320R probably damaging Het
Olfr1472 T A 19: 13,453,821 Q232L probably benign Het
Pcdha11 G T 18: 37,005,791 A158S probably damaging Het
Pcdhga8 T A 18: 37,727,056 D388E probably benign Het
Peg3 T C 7: 6,709,070 E1051G possibly damaging Het
Phlda2 T A 7: 143,502,181 I104F probably damaging Het
Polr2a A G 11: 69,735,513 S1604P possibly damaging Het
Pomt2 C T 12: 87,139,643 probably null Het
Ppp6r2 G A 15: 89,253,255 probably null Het
Prdm2 T G 4: 143,134,884 Q612P probably benign Het
Prr5 C A 15: 84,702,777 R243S probably damaging Het
Ptgdr2 T C 19: 10,940,869 I250T probably benign Het
Rad54l2 A T 9: 106,713,540 C462* probably null Het
Sec16a T A 2: 26,439,957 E682V probably damaging Het
Serpina3i A G 12: 104,266,466 D210G probably damaging Het
Slain2 T A 5: 72,957,405 D326E probably benign Het
Sned1 A G 1: 93,281,652 E829G probably damaging Het
Steap4 G A 5: 7,976,995 W319* probably null Het
Taar8c A G 10: 24,101,803 V37A probably benign Het
Tdrd12 T A 7: 35,485,229 Y753F probably damaging Het
Tnxb A G 17: 34,718,248 S3770G probably damaging Het
Trrap A G 5: 144,771,650 N48S possibly damaging Het
Zfp558 C A 9: 18,456,923 G190* probably null Het
Other mutations in Mocos
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Mocos APN 18 24660044 missense possibly damaging 0.88
IGL01859:Mocos APN 18 24666660 splice site probably benign
IGL01884:Mocos APN 18 24683216 missense probably damaging 1.00
IGL02174:Mocos APN 18 24695896 missense probably benign 0.00
IGL02966:Mocos APN 18 24676611 missense probably damaging 1.00
IGL02976:Mocos APN 18 24666569 missense possibly damaging 0.92
buteo UTSW 18 24666410 missense probably damaging 0.98
P0008:Mocos UTSW 18 24679606 missense probably benign 0.32
PIT4810001:Mocos UTSW 18 24686702 missense probably damaging 1.00
R0131:Mocos UTSW 18 24679762 missense probably benign 0.01
R0131:Mocos UTSW 18 24679762 missense probably benign 0.01
R0132:Mocos UTSW 18 24679762 missense probably benign 0.01
R0265:Mocos UTSW 18 24666276 missense probably benign 0.01
R0737:Mocos UTSW 18 24688987 missense probably damaging 0.98
R1231:Mocos UTSW 18 24679701 missense probably benign 0.01
R1351:Mocos UTSW 18 24660050 missense probably damaging 1.00
R1699:Mocos UTSW 18 24683216 missense probably damaging 1.00
R1853:Mocos UTSW 18 24695969 missense probably damaging 1.00
R2190:Mocos UTSW 18 24664057 missense probably benign 0.01
R2350:Mocos UTSW 18 24666656 splice site probably benign
R2680:Mocos UTSW 18 24676629 missense probably damaging 1.00
R3840:Mocos UTSW 18 24676624 missense probably damaging 1.00
R3841:Mocos UTSW 18 24676624 missense probably damaging 1.00
R3847:Mocos UTSW 18 24676662 missense probably damaging 0.99
R4059:Mocos UTSW 18 24679390 missense probably damaging 1.00
R4158:Mocos UTSW 18 24674246 missense probably damaging 0.99
R4205:Mocos UTSW 18 24666191 missense possibly damaging 0.88
R4514:Mocos UTSW 18 24683212 missense probably damaging 0.99
R4589:Mocos UTSW 18 24654038 missense probably damaging 0.99
R4667:Mocos UTSW 18 24666434 missense probably benign 0.11
R4668:Mocos UTSW 18 24666434 missense probably benign 0.11
R5162:Mocos UTSW 18 24654052 missense probably damaging 0.98
R5187:Mocos UTSW 18 24692554 missense probably damaging 0.97
R5533:Mocos UTSW 18 24674300 missense probably damaging 1.00
R5629:Mocos UTSW 18 24664085 critical splice donor site probably null
R5661:Mocos UTSW 18 24665995 splice site probably null
R5952:Mocos UTSW 18 24701387 missense possibly damaging 0.91
R5987:Mocos UTSW 18 24686693 missense probably damaging 1.00
R6173:Mocos UTSW 18 24676582 missense probably benign 0.03
R6209:Mocos UTSW 18 24666615 missense probably benign 0.41
R6376:Mocos UTSW 18 24701485 missense possibly damaging 0.50
R6416:Mocos UTSW 18 24701456 missense probably damaging 0.99
R6452:Mocos UTSW 18 24695941 missense probably benign 0.02
R6520:Mocos UTSW 18 24666390 missense probably benign 0.01
R6669:Mocos UTSW 18 24666410 missense probably damaging 0.98
R7114:Mocos UTSW 18 24666515 missense probably damaging 1.00
R7366:Mocos UTSW 18 24676616 missense probably damaging 1.00
R7690:Mocos UTSW 18 24664025 missense probably damaging 1.00
R7955:Mocos UTSW 18 24666159 missense probably damaging 1.00
R8458:Mocos UTSW 18 24666257 missense probably benign 0.00
R8762:Mocos UTSW 18 24679497 missense probably damaging 0.99
Z1176:Mocos UTSW 18 24670633 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACCCCACTCCTGTGCTTAG -3'
(R):5'- CTGGACAAAACCTCAGATGGC -3'

Sequencing Primer
(F):5'- TTAGGGGCTGGCCACCTG -3'
(R):5'- AGGCAAGCTCAGGACCTC -3'
Posted On2018-06-22