Incidental Mutation 'R6631:Olfr1472'
ID525187
Institutional Source Beutler Lab
Gene Symbol Olfr1472
Ensembl Gene ENSMUSG00000095189
Gene Nameolfactory receptor 1472
SynonymsGA_x6K02T2RE5P-3787124-3786180, MOR202-16
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R6631 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location13453280-13456086 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 13453821 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 232 (Q232L)
Ref Sequence ENSEMBL: ENSMUSP00000093915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077501] [ENSMUST00000096201]
Predicted Effect probably benign
Transcript: ENSMUST00000077501
AA Change: Q232L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000076707
Gene: ENSMUSG00000095189
AA Change: Q232L

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.4e-51 PFAM
Pfam:7TM_GPCR_Srsx 33 303 5.2e-8 PFAM
Pfam:7tm_1 39 288 6.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000096201
AA Change: Q232L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000093915
Gene: ENSMUSG00000095189
AA Change: Q232L

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 3.9e-53 PFAM
Pfam:7TM_GPCR_Srsx 34 304 2.6e-6 PFAM
Pfam:7tm_1 40 289 1.2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213561
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.9%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406C07Rik A T 9: 15,292,030 N159K probably damaging Het
Arhgef10l T C 4: 140,517,747 probably benign Het
Avil A G 10: 127,007,749 S153G possibly damaging Het
C2cd3 G A 7: 100,418,540 D877N probably damaging Het
Clca3a2 G A 3: 144,813,644 A257V probably benign Het
Cramp1l T A 17: 24,983,957 H366L probably benign Het
Cyp2c37 C T 19: 40,009,843 S393L probably damaging Het
Defb8 T A 8: 19,445,934 I37L probably benign Het
Dennd4b C A 3: 90,277,732 probably null Het
Eps8l2 G A 7: 141,356,202 R223H probably damaging Het
Erbin A G 13: 103,824,892 L1302P probably benign Het
Exoc3l A G 8: 105,295,361 W37R probably damaging Het
Fam214a A G 9: 74,953,825 D4G possibly damaging Het
Fap T C 2: 62,503,381 N668S probably damaging Het
Gas7 A G 11: 67,674,281 N250S probably damaging Het
Hist1h2bk T A 13: 22,036,221 V112E probably damaging Het
Hivep1 C A 13: 42,156,480 P732Q probably damaging Het
Irx4 G T 13: 73,268,426 A314S probably benign Het
Itgb8 A T 12: 119,180,977 L332* probably null Het
Kctd19 A G 8: 105,385,328 probably null Het
Kif14 G A 1: 136,515,959 S1290N probably benign Het
Klk1b3 C T 7: 44,201,464 T140I probably benign Het
Lama1 A G 17: 67,774,482 N1305D probably benign Het
Lrp1 A T 10: 127,574,332 V1515E probably damaging Het
Man2b1 A G 8: 85,086,811 probably null Het
Mocos A G 18: 24,699,931 T818A probably benign Het
Mpc2 G T 1: 165,479,512 W94L probably benign Het
Mrc1 G A 2: 14,238,485 V141I probably benign Het
Nalcn T C 14: 123,460,251 T538A probably benign Het
Ndufs3 G A 2: 90,902,400 T114M probably damaging Het
Noct T C 3: 51,250,200 C320R probably damaging Het
Pcdha11 G T 18: 37,005,791 A158S probably damaging Het
Pcdhga8 T A 18: 37,727,056 D388E probably benign Het
Peg3 T C 7: 6,709,070 E1051G possibly damaging Het
Phlda2 T A 7: 143,502,181 I104F probably damaging Het
Polr2a A G 11: 69,735,513 S1604P possibly damaging Het
Pomt2 C T 12: 87,139,643 probably null Het
Ppp6r2 G A 15: 89,253,255 probably null Het
Prdm2 T G 4: 143,134,884 Q612P probably benign Het
Prr5 C A 15: 84,702,777 R243S probably damaging Het
Ptgdr2 T C 19: 10,940,869 I250T probably benign Het
Rad54l2 A T 9: 106,713,540 C462* probably null Het
Sec16a T A 2: 26,439,957 E682V probably damaging Het
Serpina3i A G 12: 104,266,466 D210G probably damaging Het
Slain2 T A 5: 72,957,405 D326E probably benign Het
Sned1 A G 1: 93,281,652 E829G probably damaging Het
Steap4 G A 5: 7,976,995 W319* probably null Het
Taar8c A G 10: 24,101,803 V37A probably benign Het
Tdrd12 T A 7: 35,485,229 Y753F probably damaging Het
Tnxb A G 17: 34,718,248 S3770G probably damaging Het
Trrap A G 5: 144,771,650 N48S possibly damaging Het
Zfp558 C A 9: 18,456,923 G190* probably null Het
Other mutations in Olfr1472
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Olfr1472 APN 19 13453840 missense possibly damaging 0.46
IGL01755:Olfr1472 APN 19 13453815 missense probably damaging 1.00
IGL01885:Olfr1472 APN 19 13454085 missense probably benign 0.00
IGL02366:Olfr1472 APN 19 13454127 missense probably damaging 1.00
IGL03074:Olfr1472 APN 19 13454053 missense probably damaging 0.98
R0592:Olfr1472 UTSW 19 13453705 missense probably benign 0.00
R1085:Olfr1472 UTSW 19 13454230 missense possibly damaging 0.75
R4207:Olfr1472 UTSW 19 13454471 missense probably benign 0.15
R4856:Olfr1472 UTSW 19 13454521 unclassified probably null
R4886:Olfr1472 UTSW 19 13454521 unclassified probably null
R5061:Olfr1472 UTSW 19 13453985 nonsense probably null
R5167:Olfr1472 UTSW 19 13454377 missense probably damaging 1.00
R5509:Olfr1472 UTSW 19 13453968 missense probably damaging 1.00
R5586:Olfr1472 UTSW 19 13454382 missense probably benign 0.02
R5987:Olfr1472 UTSW 19 13453960 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- GTATACGACAGGGTTCAGCATAG -3'
(R):5'- GTGGAATCTTGCAATCCTCTATTC -3'

Sequencing Primer
(F):5'- GTTCAGCATAGGAATCACCATAGTG -3'
(R):5'- AATCTTGCAATCCTCTATTCATGTTG -3'
Posted On2018-06-22