Incidental Mutation 'R6632:Suco'
ID 525192
Institutional Source Beutler Lab
Gene Symbol Suco
Ensembl Gene ENSMUSG00000040297
Gene Name SUN domain containing ossification factor
Synonyms AI848100, osteopotentia, Opt
MMRRC Submission 044754-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.557) question?
Stock # R6632 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 161643683-161704251 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 161655809 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1030 (M1030K)
Ref Sequence ENSEMBL: ENSMUSP00000044815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048377]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000048377
AA Change: M1030K

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044815
Gene: ENSMUSG00000040297
AA Change: M1030K

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 32 41 N/A INTRINSIC
low complexity region 117 145 N/A INTRINSIC
low complexity region 208 224 N/A INTRINSIC
low complexity region 272 284 N/A INTRINSIC
Pfam:Sad1_UNC 325 455 9e-43 PFAM
low complexity region 665 683 N/A INTRINSIC
low complexity region 745 758 N/A INTRINSIC
coiled coil region 933 1009 N/A INTRINSIC
low complexity region 1014 1030 N/A INTRINSIC
low complexity region 1105 1119 N/A INTRINSIC
low complexity region 1163 1176 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191841
Meta Mutation Damage Score 0.0632 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 100% (38/38)
MGI Phenotype PHENOTYPE: Mice homozygous for a mutation in this gene display background strain-dependent neonatal and postnatal lethality, and impaired osteoblast differentiation resulting in impaired bone formation, brittle bones, and impaired fracture repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,429,186 (GRCm39) S758P possibly damaging Het
Abca3 C G 17: 24,603,444 (GRCm39) D545E probably benign Het
Akap9 T A 5: 4,063,842 (GRCm39) probably null Het
Akr1b1 C T 6: 34,286,939 (GRCm39) V206M possibly damaging Het
Arpp21 G A 9: 111,956,424 (GRCm39) Q518* probably null Het
Atp9b G A 18: 80,851,864 (GRCm39) R410W probably damaging Het
Cacna2d3 T C 14: 28,627,222 (GRCm39) *265W probably null Het
Ccdc96 G A 5: 36,642,533 (GRCm39) E180K probably benign Het
Cep164 T C 9: 45,691,088 (GRCm39) K1231E possibly damaging Het
Cnot1 A G 8: 96,499,895 (GRCm39) probably benign Het
Cpne2 T C 8: 95,281,583 (GRCm39) V206A probably benign Het
Dchs1 A G 7: 105,411,085 (GRCm39) Y1647H probably damaging Het
Dnaaf5 A G 5: 139,156,088 (GRCm39) T590A probably benign Het
Eif4g1 A T 16: 20,504,270 (GRCm39) I1068F probably damaging Het
Ephb4 A T 5: 137,364,849 (GRCm39) K639N probably damaging Het
Gcc2 A G 10: 58,105,871 (GRCm39) probably null Het
Gm35315 A C 5: 110,227,129 (GRCm39) Y103* probably null Het
Hsd17b4 A G 18: 50,312,169 (GRCm39) K578R possibly damaging Het
Ice2 T C 9: 69,335,734 (GRCm39) S906P probably benign Het
Irx4 G T 13: 73,416,545 (GRCm39) A314S probably benign Het
Lama5 G A 2: 179,833,455 (GRCm39) P1519L probably damaging Het
Lrp1b A T 2: 40,615,454 (GRCm39) W3650R probably benign Het
Mcoln3 C T 3: 145,833,942 (GRCm39) H161Y probably benign Het
Mphosph10 A T 7: 64,035,567 (GRCm39) M368K probably damaging Het
Msh2 A C 17: 88,020,094 (GRCm39) K567Q possibly damaging Het
N4bp3 T C 11: 51,534,776 (GRCm39) E429G possibly damaging Het
Nrxn3 G A 12: 89,159,924 (GRCm39) A17T probably damaging Het
Or2aj6 T C 16: 19,443,773 (GRCm39) T26A probably benign Het
Or5b106 T A 19: 13,123,552 (GRCm39) Y157F probably benign Het
P4ha2 G T 11: 54,008,474 (GRCm39) R227L probably benign Het
Pfkfb4 G A 9: 108,838,630 (GRCm39) probably null Het
Ror1 A G 4: 100,299,303 (GRCm39) N892S probably benign Het
Scn9a G T 2: 66,313,846 (GRCm39) D1957E probably benign Het
Sec24a A T 11: 51,604,476 (GRCm39) Y713* probably null Het
Serpinb1b T A 13: 33,271,438 (GRCm39) F70I probably damaging Het
Setdb1 T C 3: 95,231,460 (GRCm39) Y1284C probably damaging Het
Syne1 A T 10: 5,165,667 (GRCm39) probably null Het
Other mutations in Suco
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Suco APN 1 161,661,689 (GRCm39) missense probably damaging 1.00
IGL01688:Suco APN 1 161,691,480 (GRCm39) splice site probably null
IGL01794:Suco APN 1 161,655,294 (GRCm39) missense probably benign 0.01
IGL01891:Suco APN 1 161,666,371 (GRCm39) missense probably damaging 1.00
IGL02028:Suco APN 1 161,684,428 (GRCm39) missense possibly damaging 0.95
IGL02102:Suco APN 1 161,655,274 (GRCm39) missense probably damaging 1.00
IGL02351:Suco APN 1 161,646,195 (GRCm39) missense probably benign 0.35
IGL02358:Suco APN 1 161,646,195 (GRCm39) missense probably benign 0.35
IGL02392:Suco APN 1 161,662,136 (GRCm39) missense probably benign 0.11
IGL02638:Suco APN 1 161,655,256 (GRCm39) missense probably damaging 1.00
IGL02650:Suco APN 1 161,676,322 (GRCm39) splice site probably benign
IGL03106:Suco APN 1 161,662,049 (GRCm39) missense possibly damaging 0.91
IGL03189:Suco APN 1 161,684,906 (GRCm39) unclassified probably benign
IGL03328:Suco APN 1 161,647,990 (GRCm39) missense probably damaging 0.99
girth UTSW 1 161,655,809 (GRCm39) missense possibly damaging 0.86
pleasingly UTSW 1 161,661,977 (GRCm39) missense possibly damaging 0.65
3-1:Suco UTSW 1 161,649,600 (GRCm39) intron probably benign
H8562:Suco UTSW 1 161,680,420 (GRCm39) missense probably damaging 1.00
H8786:Suco UTSW 1 161,680,420 (GRCm39) missense probably damaging 1.00
R0023:Suco UTSW 1 161,673,154 (GRCm39) splice site probably null
R0023:Suco UTSW 1 161,673,154 (GRCm39) splice site probably null
R0179:Suco UTSW 1 161,703,874 (GRCm39) splice site probably benign
R0299:Suco UTSW 1 161,681,379 (GRCm39) missense probably benign
R0418:Suco UTSW 1 161,662,419 (GRCm39) missense probably benign 0.11
R0481:Suco UTSW 1 161,689,882 (GRCm39) unclassified probably benign
R0610:Suco UTSW 1 161,691,601 (GRCm39) splice site probably benign
R0610:Suco UTSW 1 161,687,072 (GRCm39) missense probably benign
R0634:Suco UTSW 1 161,666,373 (GRCm39) missense possibly damaging 0.77
R0645:Suco UTSW 1 161,661,683 (GRCm39) missense probably damaging 1.00
R1276:Suco UTSW 1 161,685,025 (GRCm39) missense probably benign 0.10
R1720:Suco UTSW 1 161,661,623 (GRCm39) missense probably damaging 1.00
R1739:Suco UTSW 1 161,655,224 (GRCm39) critical splice donor site probably null
R1763:Suco UTSW 1 161,662,518 (GRCm39) missense possibly damaging 0.80
R1835:Suco UTSW 1 161,687,069 (GRCm39) nonsense probably null
R1988:Suco UTSW 1 161,646,380 (GRCm39) critical splice acceptor site probably null
R2939:Suco UTSW 1 161,676,220 (GRCm39) missense probably damaging 1.00
R3773:Suco UTSW 1 161,671,565 (GRCm39) splice site probably null
R3882:Suco UTSW 1 161,662,313 (GRCm39) missense probably benign 0.33
R4193:Suco UTSW 1 161,691,528 (GRCm39) missense probably benign 0.32
R4367:Suco UTSW 1 161,674,799 (GRCm39) missense probably damaging 1.00
R4397:Suco UTSW 1 161,672,421 (GRCm39) missense probably damaging 1.00
R4846:Suco UTSW 1 161,661,977 (GRCm39) missense possibly damaging 0.65
R4851:Suco UTSW 1 161,661,761 (GRCm39) missense probably damaging 1.00
R5224:Suco UTSW 1 161,662,274 (GRCm39) missense probably benign 0.06
R5329:Suco UTSW 1 161,660,999 (GRCm39) missense probably damaging 0.99
R6133:Suco UTSW 1 161,662,752 (GRCm39) nonsense probably null
R6643:Suco UTSW 1 161,687,001 (GRCm39) missense possibly damaging 0.71
R7378:Suco UTSW 1 161,689,780 (GRCm39) missense possibly damaging 0.76
R7405:Suco UTSW 1 161,655,783 (GRCm39) missense possibly damaging 0.65
R7509:Suco UTSW 1 161,672,903 (GRCm39) missense probably damaging 1.00
R7838:Suco UTSW 1 161,656,890 (GRCm39) missense probably benign 0.07
R7867:Suco UTSW 1 161,665,365 (GRCm39) missense possibly damaging 0.77
R7895:Suco UTSW 1 161,672,937 (GRCm39) splice site probably null
R8440:Suco UTSW 1 161,679,907 (GRCm39) missense probably damaging 1.00
R8453:Suco UTSW 1 161,650,586 (GRCm39) intron probably benign
R8781:Suco UTSW 1 161,645,951 (GRCm39) missense probably damaging 1.00
R8798:Suco UTSW 1 161,648,004 (GRCm39) missense probably damaging 1.00
R9292:Suco UTSW 1 161,671,574 (GRCm39) missense probably damaging 1.00
R9310:Suco UTSW 1 161,684,427 (GRCm39) missense probably damaging 1.00
R9380:Suco UTSW 1 161,646,074 (GRCm39) missense possibly damaging 0.61
R9411:Suco UTSW 1 161,666,356 (GRCm39) missense probably damaging 0.99
R9542:Suco UTSW 1 161,661,668 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTACAGTTACCATCTTGCTACAATG -3'
(R):5'- GTAGTTTGTTTTCAAGCACCATGC -3'

Sequencing Primer
(F):5'- GCTCAGCATTTCTTTGAGAA -3'
(R):5'- CTCTGTATTTATGATTTCAGAGCACC -3'
Posted On 2018-06-22