Mutagenetix > Incidental Mutation

Incidental Mutation 'R6632:Setdb1'

525200

Institutional Source

Beutler Lab

Gene Symbol

Setdb1

Ensembl Gene

ENSMUSG00000015697

Gene Name

SET domain, bifurcated 1

Synonyms

KMT1E, ESET

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6632 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

95323525-95357202 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 95324149 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 1284 (Y1284C)

Ref Sequence

ENSEMBL: ENSMUSP00000102788 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015841] [ENSMUST00000015858] [ENSMUST00000107170] [ENSMUST00000107171] [ENSMUST00000129267] [ENSMUST00000139498] [ENSMUST00000139866]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000015841
AA Change: Y1284C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000015841
Gene: ENSMUSG00000015697
AA Change: Y1284C

Domain	Start	End	E-Value	Type
low complexity region	11	23	N/A	INTRINSIC
low complexity region	121	131	N/A	INTRINSIC
TUDOR	256	318	6.16e-8	SMART
TUDOR	346	401	1.03e-9	SMART
low complexity region	451	471	N/A	INTRINSIC
low complexity region	496	516	N/A	INTRINSIC
low complexity region	529	568	N/A	INTRINSIC
MBD	615	690	4.63e-33	SMART
PreSET	697	804	1.75e-41	SMART
SET	821	1289	1.76e-41	SMART
PostSET	1292	1308	1.88e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000015858

SMART Domains

Protein: ENSMUSP00000015858
Gene: ENSMUSG00000015714

Domain	Start	End	E-Value	Type
transmembrane domain	46	68	N/A	INTRINSIC
HOX	71	132	3.08e-2	SMART
TLC	131	332	1.17e-81	SMART
low complexity region	337	360	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000107170
AA Change: Y1284C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102788
Gene: ENSMUSG00000015697
AA Change: Y1284C

Domain	Start	End	E-Value	Type
low complexity region	11	23	N/A	INTRINSIC
low complexity region	121	131	N/A	INTRINSIC
TUDOR	256	318	6.16e-8	SMART
TUDOR	346	401	1.03e-9	SMART
low complexity region	451	471	N/A	INTRINSIC
low complexity region	496	516	N/A	INTRINSIC
low complexity region	529	568	N/A	INTRINSIC
MBD	615	690	4.63e-33	SMART
PreSET	697	804	1.75e-41	SMART
SET	821	1289	1.76e-41	SMART
PostSET	1292	1308	1.88e-1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107171
AA Change: Y1283C

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000102789
Gene: ENSMUSG00000015697
AA Change: Y1283C

Domain	Start	End	E-Value	Type
low complexity region	11	23	N/A	INTRINSIC
low complexity region	121	131	N/A	INTRINSIC
TUDOR	256	318	6.16e-8	SMART
TUDOR	346	401	1.03e-9	SMART
low complexity region	451	471	N/A	INTRINSIC
low complexity region	495	515	N/A	INTRINSIC
low complexity region	528	567	N/A	INTRINSIC
MBD	614	689	4.63e-33	SMART
PreSET	696	803	1.75e-41	SMART
SET	820	1288	1.76e-41	SMART
PostSET	1291	1307	1.88e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124638

Predicted Effect

probably benign
Transcript: ENSMUST00000129267

SMART Domains

Protein: ENSMUSP00000121110
Gene: ENSMUSG00000015714

Domain	Start	End	E-Value	Type
transmembrane domain	46	68	N/A	INTRINSIC
HOX	71	132	3.08e-2	SMART
transmembrane domain	136	155	N/A	INTRINSIC
transmembrane domain	175	197	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133748

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134702

Predicted Effect

probably benign
Transcript: ENSMUST00000139498

SMART Domains

Protein: ENSMUSP00000122672
Gene: ENSMUSG00000015714

Domain	Start	End	E-Value	Type
Pfam:Homeobox	65	127	5.2e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000139866

SMART Domains

Protein: ENSMUSP00000120190
Gene: ENSMUSG00000015714

Domain	Start	End	E-Value	Type
transmembrane domain	46	68	N/A	INTRINSIC
HOX	71	132	3.08e-2	SMART
TLC	131	246	4.28e-11	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142398

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154055

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156850

Meta Mutation Damage Score

0.9651

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.3%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a histone methyltransferase which regulates histone methylation, gene silencing, and transcriptional repression. This gene has been identified as a target for treatment in Huntington Disease, given that gene silencing and transcription dysfunction likely play a role in the disease pathogenesis. Alternatively spliced transcript variants of this gene have been described.[provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous inactivation of this locus results in peri-implantation lethality. Inner cell mass growth is impaired in null blastocysts. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	T	C	13: 77,281,067	S758P	possibly damaging	Het
Abca3	C	G	17: 24,384,470	D545E	probably benign	Het
Akap9	T	A	5: 4,013,842		probably null	Het
Akr1b3	C	T	6: 34,310,004	V206M	possibly damaging	Het
Arpp21	G	A	9: 112,127,356	Q518*	probably null	Het
Atp9b	G	A	18: 80,808,649	R410W	probably damaging	Het
Cacna2d3	T	C	14: 28,905,265	*265W	probably null	Het
Ccdc96	G	A	5: 36,485,189	E180K	probably benign	Het
Cep164	T	C	9: 45,779,790	K1231E	possibly damaging	Het
Cnot1	A	G	8: 95,773,267		probably benign	Het
Cpne2	T	C	8: 94,554,955	V206A	probably benign	Het
Dchs1	A	G	7: 105,761,878	Y1647H	probably damaging	Het
Dnaaf5	A	G	5: 139,170,333	T590A	probably benign	Het
Eif4g1	A	T	16: 20,685,520	I1068F	probably damaging	Het
Ephb4	A	T	5: 137,366,587	K639N	probably damaging	Het
Gcc2	A	G	10: 58,270,049		probably null	Het
Gm35315	A	C	5: 110,079,263	Y103*	probably null	Het
Hsd17b4	A	G	18: 50,179,102	K578R	possibly damaging	Het
Ice2	T	C	9: 69,428,452	S906P	probably benign	Het
Irx4	G	T	13: 73,268,426	A314S	probably benign	Het
Lama5	G	A	2: 180,191,662	P1519L	probably damaging	Het
Lrp1b	A	T	2: 40,725,442	W3650R	probably benign	Het
Mcoln3	C	T	3: 146,128,187	H161Y	probably benign	Het
Mphosph10	A	T	7: 64,385,819	M368K	probably damaging	Het
Msh2	A	C	17: 87,712,666	K567Q	possibly damaging	Het
N4bp3	T	C	11: 51,643,949	E429G	possibly damaging	Het
Nrxn3	G	A	12: 89,193,154	A17T	probably damaging	Het
Olfr1459	T	A	19: 13,146,188	Y157F	probably benign	Het
Olfr171	T	C	16: 19,625,023	T26A	probably benign	Het
P4ha2	G	T	11: 54,117,648	R227L	probably benign	Het
Pfkfb4	G	A	9: 109,009,562		probably null	Het
Ror1	A	G	4: 100,442,106	N892S	probably benign	Het
Scn9a	G	T	2: 66,483,502	D1957E	probably benign	Het
Sec24a	A	T	11: 51,713,649	Y713*	probably null	Het
Serpinb1b	T	A	13: 33,087,455	F70I	probably damaging	Het
Suco	A	T	1: 161,828,240	M1030K	possibly damaging	Het
Syne1	A	T	10: 5,215,667		probably null	Het

Other mutations in Setdb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00577:Setdb1	APN	3	95338577	missense	probably damaging	1.00
IGL00915:Setdb1	APN	3	95346788	missense	probably damaging	1.00
IGL01339:Setdb1	APN	3	95338580	nonsense	probably null
IGL01710:Setdb1	APN	3	95338853	missense	probably damaging	1.00
IGL02795:Setdb1	APN	3	95327373	missense	probably damaging	1.00
IGL02824:Setdb1	APN	3	95339904	splice site	probably benign
IGL02838:Setdb1	APN	3	95337268	splice site	probably null
IGL03014:Setdb1	UTSW	3	95341415	missense	probably damaging	1.00
R0077:Setdb1	UTSW	3	95341451	missense	probably damaging	1.00
R0344:Setdb1	UTSW	3	95326131	unclassified	probably benign
R0367:Setdb1	UTSW	3	95349881	splice site	probably benign
R0374:Setdb1	UTSW	3	95324853	unclassified	probably benign
R0411:Setdb1	UTSW	3	95327686	missense	probably damaging	1.00
R0501:Setdb1	UTSW	3	95338829	missense	probably benign	0.00
R0521:Setdb1	UTSW	3	95338829	missense	probably benign	0.00
R0616:Setdb1	UTSW	3	95341798	missense	probably damaging	1.00
R0828:Setdb1	UTSW	3	95338860	missense	probably damaging	1.00
R0990:Setdb1	UTSW	3	95340265	missense	probably benign	0.00
R1263:Setdb1	UTSW	3	95327611	missense	probably damaging	0.99
R1297:Setdb1	UTSW	3	95349876	splice site	probably benign
R1497:Setdb1	UTSW	3	95327467	missense	probably benign	0.44
R2885:Setdb1	UTSW	3	95340195	missense	probably benign
R2907:Setdb1	UTSW	3	95327201	splice site	probably benign
R3236:Setdb1	UTSW	3	95338754	missense	probably damaging	0.99
R3237:Setdb1	UTSW	3	95338754	missense	probably damaging	0.99
R3972:Setdb1	UTSW	3	95341338	missense	probably damaging	1.00
R4260:Setdb1	UTSW	3	95327497	missense	probably damaging	0.96
R5284:Setdb1	UTSW	3	95327570	missense	probably damaging	1.00
R5484:Setdb1	UTSW	3	95337258	missense	probably damaging	1.00
R5955:Setdb1	UTSW	3	95338842	missense	probably damaging	1.00
R6542:Setdb1	UTSW	3	95340307	missense	probably damaging	1.00
R6610:Setdb1	UTSW	3	95328577	missense	probably damaging	1.00
R6785:Setdb1	UTSW	3	95326401	missense	probably benign	0.09
R7176:Setdb1	UTSW	3	95337147	critical splice donor site	probably null
R7250:Setdb1	UTSW	3	95354541	critical splice donor site	probably null
R7259:Setdb1	UTSW	3	95339913	missense	probably benign	0.08
R7282:Setdb1	UTSW	3	95338674	missense	probably damaging	1.00
R7497:Setdb1	UTSW	3	95341828	missense	probably damaging	1.00
R7553:Setdb1	UTSW	3	95346765	missense	probably damaging	1.00
R7921:Setdb1	UTSW	3	95326399	missense	possibly damaging	0.85
R8022:Setdb1	UTSW	3	95338599	missense	probably damaging	1.00
R8022:Setdb1	UTSW	3	95347085	missense	probably damaging	1.00
R8189:Setdb1	UTSW	3	95346711	missense	probably damaging	1.00
R8558:Setdb1	UTSW	3	95354668	missense	possibly damaging	0.88
R8693:Setdb1	UTSW	3	95341730	missense	probably damaging	0.99
R8812:Setdb1	UTSW	3	95356060	missense	probably damaging	1.00
R8940:Setdb1	UTSW	3	95356172	missense	probably benign
R9207:Setdb1	UTSW	3	95338802	missense	possibly damaging	0.82
R9509:Setdb1	UTSW	3	95354589	missense	possibly damaging	0.48
R9784:Setdb1	UTSW	3	95325862	missense	probably damaging	1.00
Z1177:Setdb1	UTSW	3	95338530	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGAGACTTGGGGTCAGAG -3'
(R):5'- CAACCTGTTTGTCCAGAATGTG -3'

Sequencing Primer
(F):5'- ACTTGGGGTCAGAGTTCAACAGTC -3'
(R):5'- GTGGATACCCATGATCTTCGC -3'

Posted On

2018-06-22